Gene/Protein Characteristic Table for KIAA1052
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00724
Accession No AB028975
Description centrosomal protein 164kDa, transcript variant 2
Clone name hh04964
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5817 bp)
Predicted protein sequence (1456 aa)
Flexi ORF Clone FXC00724
Source Human adult brain
Rouge ID mKIAA1052 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5817 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 1456 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG09950 0 100.0 centrosomal pro...
synthetic construct
EAW67321 0 99.9 centrosomal pro...
Homo sapiens
EAW67319 0 99.3 centrosomal pro...
Homo sapiens
Q9UPV0 0 99.2 Centrosomal pro...
Homo sapiens
EAW67320 0 99.1 centrosomal pro...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB037740 3.6e-05 24.3 KIAA1319
AB007914 0.00021 25.0 KIAA0445
AB111886 0.00065 25.9 KIAA2034
AB032993 0.00081 23.9 KIAA1167
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001202 59 88 PF00397 WW/Rsp5/WWP
HMMSmart IPR001202 58 90 SM00456 WW/Rsp5/WWP
ProfileScan IPR001202 57 90 PS50020 WW/Rsp5/WWP
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CTGCCTGCCTTCTTCCATCTG
Primer_r ACAAGTCCACACATTTTAGCC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 11
Experimental conditions
Panel name GeneBridge 4
Primer_f CTGCCTGCCTTCTTCCATCTG
Primer_r ACAAGTCCACACATTTTAGCC
PCR product length 146 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp