Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00873 |
---|---|
Accession No | AB046809 |
Description | zinc finger, FYVE domain containing 1, transcript variant 1 |
Clone name | fj08951 |
Vector information | |
cDNA sequence | DNA sequence (4310 bp) Predicted protein sequence (816 aa) |
HaloTag ORF Clone |
FHC00873
|
Flexi ORF Clone | FXC00873 |
Source | Human fetal brain |
Rouge ID |
mKIAA1589
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1430 bp |
---|---|
Genome contig ID | gi51511730r_72405913 |
PolyA signal sequence (CATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 14 | r | 72505913 | 72563498 | 12 | 99.8 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000306 | 632 | 699 | PF01363 | Zinc finger |
IPR000306 | 749 | 815 | PF01363 | Zinc finger | |
HMMSmart | IPR000306 | 629 | 699 | SM00064 | Zinc finger |
IPR000306 | 746 | 815 | SM00064 | Zinc finger | |
ProfileScan | IPR000306 | 637 | 698 | PS50178 | Zinc finger |
IPR000306 | 754 | 814 | PS50178 | Zinc finger |
RT-PCR-ELISA |
Primer_f | AATCATGGGAAGGAAGGAGTG |
---|---|
Primer_r | GGAAGCAGATGTTTTGGGCAC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | CCR |
---|---|
Primer_f | TTTAGGGAAGTATATGGCGGT |
Primer_r | GGATGGTACACAGTTCTAGAG |
PCR product length | 142 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |