KIAA1589

Product ID	ORK00873
Accession No	AB046809
Description	zinc finger, FYVE domain containing 1, transcript variant 1
Clone name	fj08951
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4310 bp) Predicted protein sequence (816 aa)
HaloTag ORF Clone	FHC00873
Flexi ORF Clone	FXC00873
Source	Human fetal brain
Rouge ID	mKIAA1589 by Kazusa Mouse cDNA Project

Length: 4310 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1430 bp
Genome contig ID	gi51511730r_72405913
PolyA signal sequence (CATAAA,-19)	+--------+--------+----*----+---- CCATCCAATTCGCCATCATAAAGGAATCTTCCTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCTCGACTGTGCTGGCTCTTTCCTCTCATTCCATCAGTGCCTTCCAGCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	r	72505913	72563498	12	99.8	Perfect prediction

Length: 816 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9HBF4	100.0	Zinc finger FYV...	Homo sapiens
XP_522899	99.6	zinc finger, FY...	Pan troglodytes
Q5RFL4	99.5	Zinc finger FYV...	Pongo abelii
XP_547890	96.9	similar to Zinc...	Canis lupus fam...
XP_001488809	97.0	similar to zinc...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040970	6.5e-07	36.1	KIAA1537
AB046863	1.4e-06	38.8	KIAA1643
AB014547	2.9e-06	45.8	KIAA0647
AB002369	5.7e-06	44.1	KIAA0371
AB037783	4.8e-05	27.7	KIAA1362

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000306	632	699	PF01363	Zinc finger
HMMPfam	IPR000306	749	815	PF01363	Zinc finger
HMMSmart	IPR000306	629	699	SM00064	Zinc finger
HMMSmart	IPR000306	746	815	SM00064	Zinc finger
ProfileScan	IPR000306	637	698	PS50178	Zinc finger
ProfileScan	IPR000306	754	814	PS50178	Zinc finger

Primer_f	AATCATGGGAAGGAAGGAGTG
Primer_r	GGAAGCAGATGTTTTGGGCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	TTTAGGGAAGTATATGGCGGT
Primer_r	GGATGGTACACAGTTCTAGAG
PCR product length	142 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles