Order Kazusa clone(s) from : ![]() |
Product ID | ORK05017 |
---|---|
Accession No | AB037783 |
Description | FYVE, RhoGEF and PH domain containing 6 |
Clone name | fj02381 |
Vector information | |
cDNA sequence | DNA sequence (3842 bp) Predicted protein sequence (699 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1362
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1741 bp |
---|---|
Genome contig ID | gi89161190r_93898158 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99718 - 99669) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 12 | r | 93997876 | 94127187 | 20 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000219 | 207 | 391 | PF00621 | DH |
IPR001849 | 422 | 515 | PF00169 | Pleckstrin-like | |
IPR000306 | 549 | 614 | PF01363 | Zinc finger | |
HMMSmart | IPR000219 | 207 | 391 | SM00325 | DH |
IPR001849 | 422 | 517 | SM00233 | Pleckstrin-like | |
IPR000306 | 546 | 614 | SM00064 | Zinc finger | |
ProfileScan | IPR000219 | 203 | 392 | PS50010 | DH |
IPR001849 | 421 | 515 | PS50003 | Pleckstrin-like | |
IPR000306 | 554 | 613 | PS50178 | Zinc finger | |
IPR001849 | 665 | 699 | PS50003 | Pleckstrin-like | |
ScanRegExp | IPR001304 | 560 | 584 | PS00615 | C-type lectin |
![]() |
Primer_f | CAAGTCTGTTACAAGCCTCTG |
---|---|
Primer_r | ACATTTGCATCAGCGTCCTCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CAAGTCTGTTACAAGCCTCTG |
Primer_r | ACATTTGCATCAGCGTCCTCC |
PCR product length | 159 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |