Gene/Protein Characteristic Table for KIAA0337
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04164
Accession No AB002335
Description Rho guanine nucleotide exchange factor (GEF) 17
Clone name hg01226
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6289 bp)
Predicted protein sequence (1609 aa)
Source Human adult brain
Rouge ID mKIAA0337 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 6289 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 1609 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q96PE2 0 99.9 Rho guanine nuc...
Homo sapiens
XP_001115376 0 96.5 similar to Rho ...
Macaca mulatta
XP_001917491 0 93.2 Rho guanine nuc...
Equus caballus
XP_851853 0 93.1 similar to Rho ...
Canis lupus fam...
EDL16482 0 89.6 mCG116432, isof...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB046846 7e-13 23.5 KIAA1626
AB002292 4.8e-12 23.8 KIAA0294
AB028989 8e-09 24.0 KIAA1066
AB011088 1.3e-08 23.9 KIAA0516
AB037836 3.8e-07 30.9 KIAA1415
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000219 616 799 PF00621 DH
HMMSmart IPR000219 616 799 SM00325 DH
ProfileScan IPR000219 612 800 PS50010 DH
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f CCACCCACCCCAAACAAAACC
Primer_r TCTACCTGACCCCCTGGACCA
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 11
Experimental conditions
Panel name GeneBridge 4
Primer_f CCACCCACCCCAAACAAAACC
Primer_r TCTACCTGACCCCCTGGACCA
PCR product length 137 bp
PCR conditions 95 °C15 sec66 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp