KIAA1066

Product ID	ORK00728
Accession No	AB028989
Description	mitogen-activated protein kinase 8 interacting protein 3, transcript variant 1
Clone name	ah03682
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5621 bp) Predicted protein sequence (1346 aa)
HaloTag ORF Clone	FHC00728
Flexi ORF Clone	FXC00728
Source	Human brain (amygdala)
Rouge ID	mKIAA1066 by Kazusa Mouse cDNA Project
Note	We replaced hj05363b, former representative clones for KIAA1066 with ah03682. (2002/12/27)

Length: 5621 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1490 bp
Genome contig ID	gi51511732f_1596222
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- ATATCTGCTCTGTATGTAATAAATGTCTTAACGTC
Flanking genome sequence (164096 - 164145)	----+--------+--------+--------+--------+----* GTAGCTGCCTGTTCCTGGGCCCAAATCGAAACGAAAACGAGGACTTTATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	1696222	1760316	31	99.6	Perfect prediction

Length: 1346 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UPT6	100.0	C-jun-amino-ter...	Homo sapiens
AAI44487	99.8	MAPK8IP3 protei...	Homo sapiens
EAW85631	99.6	mitogen-activat...	Homo sapiens
NP_001035529	99.6	mitogen-activat...	Homo sapiens
EAW85632	99.4	mitogen-activat...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011088	2.3e-86	57.1	KIAA0516
AB002335	2e-09	24.0	KIAA0337
AB046846	1.5e-08	30.7	KIAA1626
AB002292	5.1e-07	30.0	KIAA0294

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	ATGTATGTCCGCTCCCTCGTC
Primer_r	TATGTGGGTTTGCTTGCAGGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ATGTATGTCCGCTCCCTCGTC
Primer_r	TATGTGGGTTTGCTTGCAGGG
PCR product length	124 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles