Order Kazusa clone(s) from : ![]() |
Product ID | ORK00728 |
---|---|
Accession No | AB028989 |
Description | mitogen-activated protein kinase 8 interacting protein 3, transcript variant 1 |
Clone name | ah03682 |
Vector information | |
cDNA sequence | DNA sequence (5621 bp) Predicted protein sequence (1346 aa) |
Flexi ORF Clone | FXC00728 |
Source | Human brain (amygdala) |
Rouge ID |
mKIAA1066
by Kazusa Mouse cDNA Project
|
Note | We replaced hj05363b, former representative clones for KIAA1066 with ah03682. (2002/12/27) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1490 bp |
---|---|
Genome contig ID | gi51511732f_1596222 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (164096 - 164145) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 16 | f | 1696222 | 1760316 | 31 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | ATGTATGTCCGCTCCCTCGTC |
---|---|
Primer_r | TATGTGGGTTTGCTTGCAGGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ATGTATGTCCGCTCCCTCGTC |
Primer_r | TATGTGGGTTTGCTTGCAGGG |
PCR product length | 124 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |