KIAA0516

Product ID	ORK06955
Accession No	AB011088
Description	sperm associated antigen 9
Clone name	hg00484s2
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4437 bp) Predicted protein sequence (1382 aa)
Source	Human adult brain
Rouge ID	mKIAA0516 by Kazusa Mouse cDNA Project
Note	We replaced hg00484 and hg00484s1, former representative clones for KIAA0516 with hg00484s2. (2002/5/10,2005/08/06)

Length: 4437 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	284 bp
Genome contig ID	gi51511734r_46298348
PolyA signal sequence (None)	+--------+--------+----*----+---- CAAACTGGTGAATTATAGAAAGCAATCCAGATGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GTTTACTCTGCCACAGTCTAATGTCATTCACTTCATTTGATGGGGTCACT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	46398348	46553203	30	100.0	Perfect prediction

Length: 1382 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O60271	100.0	C-jun-amino-ter...	Homo sapiens
XP_001171175	99.8	sperm associate...	Pan troglodytes
XP_852670	97.6	similar to sper...	Canis lupus fam...
Q58A65	96.5	C-jun-amino-ter...	Mus musculus
BAD93176	96.4	JSAP2a [Mus mus...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028989	1.9e-70	57.1	KIAA1066
AB002335	4.9e-07	23.8	KIAA0337
AB046846	1e-05	25.9	KIAA1626
AB002292	6.3e-05	26.1	KIAA0294

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	CTCGGGACATTTAGATACATC
Primer_r	TGGGGTCACTTGTTAGCTGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CTCGGGACATTTAGATACATC
Primer_r	TGGGGTCACTTGTTAGCTGTC
PCR product length	162 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles