Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01064 |
---|---|
Accession No | AB002292 |
Description | Rho guanine nucleotide exchange factor (GEF) 10, transcript variant 1 |
Clone name | hf00223s1 |
Vector information | |
cDNA sequence | DNA sequence (5589 bp) Predicted protein sequence (1405 aa) |
HaloTag ORF Clone |
FHC01064
|
Flexi ORF Clone | FXC01064 |
Source | Human adult brain |
Rouge ID |
mKIAA0294
by Kazusa Mouse cDNA Project
|
Note | We replaced hf00223, former representative clones for KIAA0294 with hf00223s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1370 bp |
---|---|
Genome contig ID | gi51511724f_1678924 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (215284 - 215333) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 8 | f | 1759549 | 1894206 | 29 | 99.6 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000219 | 461 | 643 | PF00621 | DH |
HMMSmart | IPR000219 | 461 | 643 | SM00325 | DH |
ProfileScan | IPR000219 | 457 | 644 | PS50010 | DH |
ScanRegExp | IPR000169 | 1205 | 1215 | PS00639 | Peptidase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1145 | GMVISHMAVSGVGIWIAFTSGST | 1167 | SECONDARY | 23 | 2 | 1201 | TSLLVCHGLLMVGTSLGVLVALP | 1223 | PRIMARY | 23 |
---|
RT-PCR |
---|
Primer_f | TCTTAAAATCTACCGCCAACG |
---|---|
Primer_r | ACACCTCCATCTACTATTCGG |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TCTTAAAATCTACCGCCAACG |
Primer_r | ACACCTCCATCTACTATTCGG |
PCR product length | 110 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |