Order Kazusa clone(s) from : ![]() |
Product ID | ORK00047 |
---|---|
Accession No | AB002303 |
Description | zinc finger, FYVE domain containing 16, transcript variant 1 |
Clone name | hg00042 |
Vector information | |
cDNA sequence | DNA sequence (6632 bp) Predicted protein sequence (1547 aa) |
HaloTag ORF Clone |
FHC00047
![]() |
Flexi ORF Clone | FXC00047 |
Source | Human adult brain |
Rouge ID |
mKIAA0305
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1764 bp |
---|---|
Genome contig ID | gi51511721f_79639648 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (171069 - 171118) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | f | 79739648 | 79810715 | 19 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
---|
Primer_f | CTTCAAAATGTGCCTCCAAAC |
---|---|
Primer_r | GTAGAGGGCTGTTCCATGATG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTTCAAAATGTGCCTCCAAAC |
Primer_r | GTAGAGGGCTGTTCCATGATG |
PCR product length | 108 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |