KIAA0305

Product ID	ORK00047
Accession No	AB002303
Description	zinc finger, FYVE domain containing 16, transcript variant 1
Clone name	hg00042
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6632 bp) Predicted protein sequence (1547 aa)
HaloTag ORF Clone	FHC00047
Flexi ORF Clone	FXC00047
Source	Human adult brain
Rouge ID	mKIAA0305 by Kazusa Mouse cDNA Project

Length: 6632 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1764 bp
Genome contig ID	gi51511721f_79639648
PolyA signal sequence (None)	+--------+--------+----*----+---- TTATGTGCCTGAAGTTTGGAGGCACATTTTGAAGT
Flanking genome sequence (171069 - 171118)	----+--------+--------+--------+--------+----* ATTCTTTGTAGACATATAGTATGTTTCTGAATGTGTTTGTTACTTATTTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	79739648	79810715	19	99.4	Perfect prediction

Length: 1547 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q7Z3T8	100.0	Zinc finger FYV...	Homo sapiens
NP_055548	99.9	zinc finger, FY...	Homo sapiens
CAI45932	99.9	hypothetical pr...	Homo sapiens
CAD97666	99.9	hypothetical pr...	Homo sapiens
XP_001135982	98.4	endosome-associ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037783	6.7e-10	30.0	KIAA1362
AB014547	1.6e-07	36.2	KIAA0647
AB040970	9.6e-07	21.8	KIAA1537
AB002369	3.4e-06	44.4	KIAA0371
AB002319	4.8e-06	28.0	KIAA0321

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000306	750	814	PF01363	Zinc finger
HMMSmart	IPR000306	747	814	SM00064	Zinc finger
ProfileScan	IPR000306	755	813	PS50178	Zinc finger

Primer_f	CTTCAAAATGTGCCTCCAAAC
Primer_r	GTAGAGGGCTGTTCCATGATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CTTCAAAATGTGCCTCCAAAC
Primer_r	GTAGAGGGCTGTTCCATGATG
PCR product length	108 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles