Gene/Protein Characteristic Table for KIAA0321
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07424
Accession No AB002319
Description zinc finger, FYVE domain containing 26
Clone name hg00426
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6540 bp)
Predicted protein sequence (1542 aa)
Source Human adult brain
Rouge ID mKIAA0321 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 6540 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1542 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q68DK2 0 100.0 Zinc finger FYV...
Homo sapiens
EAW80953 0 99.9 zinc finger, FY...
Homo sapiens
BAG72892 0 99.9 zinc finger, FY...
synthetic construct
BAG11658 0 99.9 FYVE domain con...
Homo sapiens
NP_056161 0 99.9 zinc finger, FY...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB037783 8.6e-07 36.0 KIAA1362
AB002303 4.7e-05 28.0 KIAA0305
AB046863 0.00014 40.6 KIAA1643
AB040970 0.00036 33.3 KIAA1537
AB023210 0.00046 35.4 KIAA0993
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000306 810 876 PF01363 Zinc finger
HMMSmart IPR000306 807 876 SM00064 Zinc finger
ProfileScan IPR000306 815 875 PS50178 Zinc finger
ScanRegExp IPR007087 566 590 PS00028 Zinc finger
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f TGGGTATCTGTTTTGGTGGTG
Primer_r CCTGACATTTTCCTCTAACTC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 14
Experimental conditions
Panel name GeneBridge 4
Primer_f TGGGTATCTGTTTTGGTGGTG
Primer_r CCTGACATTTTCCTCTAACTC
PCR product length 137 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp