KIAA0993

Product ID	ORK07349
Accession No	AB023210
Description	WD repeat and FYVE domain containing 3
Clone name	bf03014
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (7998 bp) Predicted protein sequence (1556 aa)
Source	Human adult brain
Rouge ID	mKIAA0993 by Kazusa Mouse cDNA Project
Note	We replaced hk07603, former representative clones for KIAA0993 with bf03014. (2002/5/10)

Length: 7998 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3326 bp
Genome contig ID	gi89161207r_85709719
PolyA signal sequence (AATAAA,-30)	+--------+--------+----*----+---- TTTCAAATAAATACCTATTTACCACCAAAAGAAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAGAAAAGTTGTTAAGTCAGTTATTCAGGGAAGGAAAAACAGAGATC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	r	85809719	85891723	33	100.0	Perfect prediction

Length: 1556 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI50247	100.0	WDFY3 protein [...	Homo sapiens
Q8IZQ1	100.0	WD repeat and F...	Homo sapiens
XP_001151618	99.9	WD repeat and F...	Pan troglodytes
AAN15137	99.9	ALFY [Homo sapi...	Homo sapiens
XP_001495037	98.1	WD repeat and F...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046827	1.1e-59	38.5	KIAA1607
AB046764	5.2e-53	39.8	KIAA1544
AB011112	2.3e-52	36.2	KIAA0540
AB014547	1.1e-06	29.1	KIAA0647
AB037783	3.2e-06	40.2	KIAA1362

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	1153	1186	PD000018	WD40 repeat
FPrintScan	IPR001680	1123	1137	PR00320	WD40 repeat
	IPR001680	1172	1186	PR00320	WD40 repeat
	IPR001680	1262	1276	PR00320	WD40 repeat
HMMPfam	IPR000409	725	1006	PF02138	Beige/BEACH
	IPR001680	1147	1185	PF00400	WD40 repeat
	IPR001680	1189	1226	PF00400	WD40 repeat
	IPR001680	1232	1275	PF00400	WD40 repeat
	IPR000306	1479	1545	PF01363	Zinc finger
HMMSmart	IPR001680	1102	1136	SM00320	WD40 repeat
	IPR001680	1146	1185	SM00320	WD40 repeat
	IPR001680	1188	1226	SM00320	WD40 repeat
	IPR001680	1231	1275	SM00320	WD40 repeat
	IPR001680	1429	1468	SM00320	WD40 repeat
	IPR000306	1476	1545	SM00064	Zinc finger
ProfileScan	IPR000409	713	1006	PS50197	Beige/BEACH
	IPR001680	1118	1284	PS50294	WD40 repeat
	IPR001680	1153	1194	PS50082	WD40 repeat
	IPR000306	1484	1544	PS50178	Zinc finger
ScanRegExp	IPR001680	1172	1186	PS00678	WD40 repeat

Primer_f	CTAAGACTGGATTGATTGTGG
Primer_r	ATATCACAGACTGCACACTAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-