KIAA0540

Product ID	ORK06104
Accession No	AB011112
Description	neurobeachin-like 2
Clone name	pg00116
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6364 bp) Predicted protein sequence (2041 aa)
Source	Human brain (hippocampus)
Rouge ID	mKIAA0540 by Kazusa Mouse cDNA Project
Note	We replaced hg04185, former representative clones for KIAA0540 with pg00116. (2002/5/10)

Length: 6364 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	236 bp
Genome contig ID	gi89161205f_46911815
PolyA signal sequence (None)	+--------+--------+----*----+---- CCGCCCTGAGGGCCAGCACTGGCGTCTGCGGCCGC
Flanking genome sequence (114237 - 114286)	----+--------+--------+--------+--------+----* AGCAGCACTTTTTGCACAGTCTGGGGCGGGGTTCCCCGGCTTCCAAGTCG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	47011815	47026050	40	99.9	Perfect prediction

Length: 2041 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW64803	100.0	hCG15426, isofo...	Homo sapiens
BAC85154	91.7	FLJ00341 protei...	Homo sapiens
XP_001916603	85.3	neurobeachin-li...	Equus caballus
XP_236649	82.3	similar to neur...	Rattus norvegicus
Q6ZQA0	81.3	Neurobeachin-li...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046764	2e-55	33.7	KIAA1544
AB023210	2.6e-49	36.2	KIAA0993
AB046827	2.8e-46	30.0	KIAA1607

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000409	1352	1632	PF02138	Beige/BEACH
	IPR001680	1779	1817	PF00400	WD40 repeat
	IPR001680	1830	1868	PF00400	WD40 repeat
HMMSmart	IPR001680	1730	1775	SM00320	WD40 repeat
	IPR001680	1778	1817	SM00320	WD40 repeat
	IPR001680	1829	1868	SM00320	WD40 repeat
ProfileScan	IPR000409	1340	1632	PS50197	Beige/BEACH
	IPR001680	1742	1877	PS50294	WD40 repeat
	IPR001680	1785	1818	PS50082	WD40 repeat
	IPR001680	1836	1877	PS50082	WD40 repeat

Primer_f	GCACATCCTCCAACTAAACAC
Primer_r	AGTAGGGTTGTATTCCGTCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GCACATCCTCCAACTAAACAC
Primer_r	AGTAGGGTTGTATTCCGTCTC
PCR product length	247 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles