KIAA1544

Product ID	ORK06103
Accession No	AB046764
Description	neurobeachin
Clone name	fh02556
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4831 bp) Predicted protein sequence (1028 aa)
Source	Human fetal brain
Rouge ID	mKIAA1544 by Kazusa Mouse cDNA Project

Length: 4831 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1744 bp
Genome contig ID	gi51511729f_34662524
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ATCAAAAAAAGAAAAATAAAATATGCAAAGAATTC
Flanking genome sequence (482350 - 482399)	----+--------+--------+--------+--------+----* ACCGACTGTTTCAGATTTCATTGGACATGTCACTAGCATGCTTTCATTGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	13	f	34704735	35144872	25	99.6	Perfect prediction

Length: 1028 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG53781	99.9	unnamed protein...	Homo sapiens
EAX08543	100.0	neurobeachin, i...	Homo sapiens
CAH72182	100.0	neurobeachin [H...	Homo sapiens
NP_056493	100.0	neurobeachin [H...	Homo sapiens
Q8NFP9	100.0	Neurobeachin; L...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011112	9.5e-75	33.8	KIAA0540
AB023210	1.7e-67	39.9	KIAA0993
AB046827	1.5e-61	38.0	KIAA1607

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010508	48	215	PF06469	Protein of unknown function DUF1088
	IPR000409	368	645	PF02138	Beige/BEACH
	IPR001680	792	834	PF00400	WD40 repeat
	IPR001680	976	1014	PF00400	WD40 repeat
HMMSmart	IPR001680	751	788	SM00320	WD40 repeat
	IPR001680	791	834	SM00320	WD40 repeat
	IPR001680	851	890	SM00320	WD40 repeat
	IPR001680	934	972	SM00320	WD40 repeat
	IPR001680	975	1014	SM00320	WD40 repeat
ProfileScan	IPR000409	356	645	PS50197	Beige/BEACH
ProfileScan	IPR001680	940	1023	PS50294	WD40 repeat

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	689	LPHLTIPAVVTVTCSRLFAVNRW	711	SECONDARY	23
SOSUI2	2	863	HEVVCVSVCAELGLVISGAKEGP	885	PRIMARY	23

Primer_f	CCCTGCATAATTTGAAGACAC
Primer_r	TAGCATCAGATTATCCTCCCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-