KIAA0793

Product ID	ORK04986
Accession No	AB018336
Description	FERM, RhoGEF and pleckstrin domain protein 2
Clone name	hk05692
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3997 bp) Predicted protein sequence (1055 aa)
Source	Human adult brain
Rouge ID	mKIAA0793 by Kazusa Mouse cDNA Project

Length: 3997 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	715 bp
Genome contig ID	gi89161199f_241844384
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ACATTTGATTAAAAATAAACAAACAGCATCTCCCC
Flanking genome sequence (238546 - 238595)	----+--------+--------+--------+--------+----* ACCTGCATTCTCCTCTGCCTGCTCTGTTCTTCCGGTGGGCCAAGCAGAGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	241944384	242082928	27	100.0	Perfect prediction

Length: 1055 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O94887	100.0	FERM, RhoGEF an...	Homo sapiens
XP_001091489	97.0	similar to FERM...	Macaca mulatta
Q91VS8	83.5	FERM, RhoGEF an...	Mus musculus
BAE42626	83.4	unnamed protein...	Mus musculus
XP_001497741	85.5	FERM, RhoGEF an...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023204	1.8e-20	35.7	KIAA0987
AB002336	2.5e-19	34.6	KIAA0338
AB037783	2.9e-12	28.2	KIAA1362
AB046768	3.4e-07	31.3	KIAA1548
AB029035	1e-06	26.7	KIAA1112

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000798	58	77	PR00661	Ezrin/radixin/moesin ERM
	IPR000299	78	90	PR00935	Band 4.1
	IPR000798	109	128	PR00661	Ezrin/radixin/moesin ERM
	IPR000299	143	156	PR00935	Band 4.1
	IPR000798	152	173	PR00661	Ezrin/radixin/moesin ERM
	IPR000299	156	176	PR00935	Band 4.1
	IPR000299	215	231	PR00935	Band 4.1
	IPR000798	238	258	PR00661	Ezrin/radixin/moesin ERM
HMMPfam	IPR000299	47	235	PF00373	Band 4.1
	IPR014847	331	379	PF08736	FERM adjacent (FA)
	IPR000219	540	726	PF00621	DH
	IPR001849	757	853	PF00169	Pleckstrin-like
	IPR001849	931	1027	PF00169	Pleckstrin-like
HMMSmart	IPR000299	41	235	SM00295	Band 4.1
	IPR000219	540	726	SM00325	DH
	IPR001849	757	855	SM00233	Pleckstrin-like
	IPR001849	931	1029	SM00233	Pleckstrin-like
ProfileScan	IPR000299	45	325	PS50057	Band 4.1
	IPR000219	536	727	PS50010	DH
	IPR001849	756	853	PS50003	Pleckstrin-like
	IPR001849	930	1027	PS50003	Pleckstrin-like
ScanRegExp	IPR000299	99	128	PS00660	Band 4.1

Primer_f	CCGATGGCATACACAAAGACT
Primer_r	AGCCACTTCCCATCTGTTGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-