KIAA1112

Product ID	ORK00742
Accession No	AB029035
Description	Rho guanine nucleotide exchange factor (GEF) 4, transcript variant 2
Clone name	hj05505s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pYO326 vector. The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. pYO326 shuttle vector, pYO326 (Amp-r) was kindly provided by Y. Ohya (University of Tokyo).
cDNA sequence	DNA sequence (3800 bp) Predicted protein sequence (694 aa)
HaloTag ORF Clone	FHC00742
Flexi ORF Clone	FXC00742
Source	Human adult brain
Rouge ID	mKIAA1112 by Kazusa Mouse cDNA Project
Note	We replaced hj05505, former representative clones for KIAA1112 with hj05505s1. (2002/5/10)

Length: 3800 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1713 bp
Genome contig ID	gi89161199f_131291474
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- CCACATTTAATTTCATAAATAAATTTATGAAAAGT
Flanking genome sequence (229822 - 229871)	----+--------+--------+--------+--------+----* AACCTGGCTGCTAGCCCGTTTTCTGTGGGTGTGCGTGCATTTTCCTGTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	131391474	131521294	12	99.5	Perfect prediction

Length: 694 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW51271	100.0	Rho guanine nuc...	Homo sapiens
EAW51270	96.2	Rho guanine nuc...	Homo sapiens
Q9NR80	96.0	Rho guanine nuc...	Homo sapiens
AAF79955	96.6	RhoGEF [Homo sa...	Homo sapiens
XP_001504974	83.7	Rho guanine nuc...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007884	1.5e-89	58.2	KIAA0424
AB037836	1.4e-24	36.4	KIAA1415
D63476	8.7e-14	23.8	KIAA0142
AB018336	5.6e-13	26.7	KIAA0793
AB002360	8.2e-12	26.4	KIAA0362

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	233	272	PD000066	Src homology-3
FPrintScan	IPR001452	235	250	PR00452	Src homology-3
	IPR001452	252	261	PR00452	Src homology-3
	IPR001452	263	275	PR00452	Src homology-3
HMMPfam	IPR001452	221	275	PF00018	Src homology-3
	IPR000219	312	491	PF00621	DH
	IPR001849	524	630	PF00169	Pleckstrin-like
HMMSmart	IPR001452	221	276	SM00326	Src homology-3
	IPR000219	312	491	SM00325	DH
	IPR001849	524	632	SM00233	Pleckstrin-like
ProfileScan	IPR001452	225	277	PS50002	Src homology-3
	IPR000219	308	492	PS50010	DH
	IPR001849	523	630	PS50003	Pleckstrin-like
ScanRegExp	IPR001331	440	465	PS00741	Guanine-nucleotide dissociation stimulator

Primer_f	GCGTGAGAAGCCATAAGAGAG
Primer_r	AATGTGGTTTCTGGCTTGGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-