KIAA0142

Product ID	ORK00426
Accession No	D63476
Description	Rho guanine nucleotide exchange factor (GEF) 7, transcript variant 1
Clone name	ha01169
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5032 bp) Predicted protein sequence (802 aa)
HaloTag ORF Clone	FHC00426
Flexi ORF Clone	FXC00426
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0142 by Kazusa Mouse cDNA Project

Length: 5032 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2618 bp
Genome contig ID	gi51511729f_110504086
PolyA signal sequence (ATTAAA,-26)	+--------+--------+----*----+---- GTTGTAATTATTAAACTGATTATTTTTCTTATGTC
Flanking genome sequence (251995 - 252044)	----+--------+--------+--------+--------+----* ACAGAATGTGTCGCTTCGTCTTCTTTGATGTGTTTTCTGTGTGCTTGTTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	13	f	110604086	110756079	20	99.4	Perfect prediction

Length: 802 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX09148	99.5	Rho guanine nuc...	Homo sapiens
BAH13248	99.7	unnamed protein...	Homo sapiens
AAH50521	99.9	Rho guanine nuc...	Homo sapiens
XP_509742	97.0	Rho guanine nuc...	Pan troglodytes
XP_001926031	94.5	similar to Rho ...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D25304	4.7e-59	59.4	KIAA0006
AB029035	1.9e-08	23.7	KIAA1112
AB033082	4.5e-07	24.5	KIAA1256
AB037836	1e-05	26.1	KIAA1415

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	166	216	PD000066	Src homology-3
FPrintScan	IPR001452	179	194	PR00452	Src homology-3
	IPR001452	196	205	PR00452	Src homology-3
	IPR001452	207	219	PR00452	Src homology-3
HMMPfam	IPR001452	165	219	PF00018	Src homology-3
	IPR000219	253	428	PF00621	DH
	IPR001849	458	556	PF00169	Pleckstrin-like
HMMSmart	IPR001452	165	220	SM00326	Src homology-3
	IPR000219	253	428	SM00325	DH
	IPR001849	458	558	SM00233	Pleckstrin-like
ProfileScan	IPR001452	162	221	PS50002	Src homology-3
	IPR000219	249	429	PS50010	DH
	IPR001849	451	556	PS50003	Pleckstrin-like
ScanRegExp	IPR001331	377	402	PS00741	Guanine-nucleotide dissociation stimulator

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	GGGTTACTCCTTTGCTCTCAC
Primer_r	AACCAGGGCAGGCATTCAAGG
PCR product length	190 bp
PCR conditions	95 °C15 sec64 °C120 sec30 cycles