KIAA1548

Product ID	ORK04901
Accession No	AB046768
Description	erythrocyte membrane protein band 4.1 like 5
Clone name	fh15779
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5850 bp) Predicted protein sequence (545 aa)
Source	Human fetal brain
Rouge ID	mKIAA1548 by Kazusa Mouse cDNA Project

Length: 5850 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4211 bp
Genome contig ID	gi89161199f_120451072
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GTAACTCTATTCAAATAAACCTTCGTGAGACATTC
Flanking genome sequence (202094 - 202143)	----+--------+--------+--------+--------+----* ATGTTTTTGTGCACTGTTTCTGTTTCTTGGAACTGTGATTCCTACATGCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	120551072	120653164	18	99.2	Perfect prediction

Length: 545 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW95233	4.3e-216	100.0	erythrocyte mem...	Homo sapiens
EAW95235	2.5e-215	99.8	erythrocyte mem...	Homo sapiens
Q9HCM4	5.2e-215	99.6	Band 4.1-like p...	Homo sapiens
XP_001157953	4.8e-212	98.4	erythrocyte mem...	Pan troglodytes
XP_001088764	1.8e-199	93.6	erythrocyte mem...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002336	1.3e-19	35.5	KIAA0338
AB023204	3e-18	39.8	KIAA0987
AB018336	1e-14	31.0	KIAA0793

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000299	1	48	PF00373	Band 4.1
HMMPfam	IPR014847	147	193	PF08736	FERM adjacent (FA)
ProfileScan	IPR000299	1	140	PS50057	Band 4.1
ScanRegExp	IPR000299	18	47	PS00661	Band 4.1

Primer_f	AACACTTCTGGACATTGCATC
Primer_r	GGAACTCACAAAGACCCTCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-