Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00252 |
---|---|
Accession No | AB046812 |
Description | cyclin and CBS domain divalent metal cation transport mediator 4 |
Clone name | fj09188 |
Vector information | |
cDNA sequence | DNA sequence (4510 bp) Predicted protein sequence (717 aa) |
HaloTag ORF Clone |
FHC00252
|
Flexi ORF Clone | FXC00252 |
Source | Human fetal brain |
Rouge ID |
mKIAA1592
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2354 bp |
---|---|
Genome contig ID | gi89161199f_96690636 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (150701 - 150750) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | f | 96790636 | 96841335 | 7 | 100.0 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR002550 | 126 | 300 | PF01595 | Protein of unknown function DUF21 |
IPR000644 | 339 | 446 | PF00571 | Cystathionine beta-synthase | |
ProfileScan | IPR000595 | 517 | 594 | PS50042 | Cyclic nucleotide-binding |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 127 | HILLITVLLVLSGIFSGLNLGLM | 149 | PRIMARY | 23 | 2 | 182 | NYLLCSLLLGNVLVNTSLTILLD | 204 | SECONDARY | 23 | 3 | 212 | MAVASSTIGIVIFGEILPQALCS | 234 | SECONDARY | 23 | 4 | 243 | NTILLTKFFMLLTFPLSFPISKL | 265 | SECONDARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | ACATCAAGATCACTCGGCAGC |
---|---|
Primer_r | TCGTTGAGAAGAGTTGTGGTC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |