Order Kazusa clone(s) from : ![]() |
Product ID | ORK00875 |
---|---|
Accession No | AB046825 |
Description | glucosidase, beta (bile acid) 2 |
Clone name | fj10791 |
Vector information | |
cDNA sequence | DNA sequence (3757 bp) Predicted protein sequence (922 aa) |
HaloTag ORF Clone |
FHC00875
![]() |
Flexi ORF Clone | FXC00875 |
Source | Human fetal brain |
Rouge ID |
mKIAA1605
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 609 bp |
---|---|
Genome contig ID | gi89161216r_35626864 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 9 | r | 35726864 | 35739215 | 17 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR006775 | 566 | 915 | PF04685 | Protein of unknown function DUF608 |
ScanRegExp | IPR002202 | 199 | 206 | PS00318 | Hydroxymethylglutaryl-coenzyme A reductase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 831 | FELNVQAFAGGAMGAVNGMQPH | 852 | SECONDARY | 22 | 2 | 871 | YGLAATMIQELLPSGFCLWVIVI | 893 | PRIMARY | 23 |
---|
![]() |
Primer_f | TTACAACTATGACAGCAGCTC |
---|---|
Primer_r | GATAGTTTGGAGAGCACGGAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |