KIAA1608

Product ID	ORK04745
Accession No	AB046828
Description	DENN/MADD domain containing 1A
Clone name	fj20142
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4797 bp) Predicted protein sequence (872 aa)
Source	Human fetal brain
Rouge ID	mKIAA1608 by Kazusa Mouse cDNA Project
Note	We replaced fj11345, former representative clones for KIAA1608 with fj20142. (2002/5/10)

Length: 4797 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1775 bp
Genome contig ID	gi89161216r_125081758
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CTTTGTGTGCATTCAATAAAATCATCTTGGGGAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GAGGCTGGCATCCCCGTGTCCTTGAAGCTTTTGGGTCGGGGAGGCCCCAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	r	125181758	125600615	18	99.4	Perfect prediction

Length: 872 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAH13155	2.2e-194	91.3	unnamed protein...	Homo sapiens
EAW87572	2.3e-194	91.0	DENN/MADD domai...	Homo sapiens
BAH12164	2.6e-194	91.5	unnamed protein...	Homo sapiens
EAW87574	2.7e-194	91.5	DENN/MADD domai...	Homo sapiens
XP_231184	1.7e-151	76.8	similar to CG18...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033103	0.00046	31.6	KIAA1277

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001194	6	171	PF02141	DENN
HMMPfam	IPR005112	202	230	PF03455	dDENN
HMMSmart	IPR001194	3	171	SM00799	DENN
ProfileScan	IPR001194	1	171	PS50211	DENN

Primer_f	TACTCCCCTCACTGTCAAAGC
Primer_r	AGTTTGTCCTTTCTACCTGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	TACTCCCCTCACTGTCAAAGC
Primer_r	AGTTTGTCCTTTCTACCTGGC
PCR product length	205 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles