KIAA1277

Product ID	ORK00794
Accession No	AB033103
Description	DENN/MADD domain containing 2A
Clone name	fj11251
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3737 bp) Predicted protein sequence (1039 aa)
HaloTag ORF Clone	FHC00794
Flexi ORF Clone	FXC00794
Source	Human fetal brain
Rouge ID	mKIAA1277 by Kazusa Mouse cDNA Project
Note	We replaced fh01940, former representative clones for KIAA1277 with fj11251. (1999/11/11)

Length: 3737 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	289 bp
Genome contig ID	gi89161213r_139764728
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- TTTTTTTATCTTAGATATTAAAAGTAAGAAAAATG
Flanking genome sequence (99961 - 99912)	----+--------+--------+--------+--------+----* TGTGGGTTTTCTGTTTATTATGCCAAGGCCAAGAGGAGCCTGTCCTGCCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	139864689	139987045	19	99.5	Perfect prediction

Length: 1039 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10024	100.0	DENN domain-con...	synthetic construct
Q9ULE3	99.9	DENN domain-con...	Homo sapiens
NP_056504	99.8	DENN/MADD domai...	Homo sapiens
XP_001154173	99.6	DENN/MADD domai...	Pan troglodytes
XP_001154109	98.9	DENN/MADD domai...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046828	6.8e-07	31.6	KIAA1608
AB007945	6.6e-05	24.7	KIAA0476
AB029014	0.0003	27.0	KIAA1091
AB051553	0.00069	24.9	KIAA1766

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005113	591	683	PF03456	uDENN
	IPR001194	690	874	PF02141	DENN
	IPR005112	925	992	PF03455	dDENN
HMMSmart	IPR005113	591	683	SM00800	uDENN
	IPR001194	690	874	SM00799	DENN
	IPR005112	925	992	SM00801	dDENN
ProfileScan	IPR005113	591	689	PS50946	uDENN
	IPR001194	690	874	PS50211	DENN
	IPR005112	925	992	PS50947	dDENN