Order Kazusa clone(s) from : ![]() |
Product ID | ORK02017 |
---|---|
Accession No | AB029014 |
Description | DENN/MADD domain containing 5A, transcript variant 1 |
Clone name | hk04373 |
Vector information | |
cDNA sequence | DNA sequence (4248 bp) Predicted protein sequence (1359 aa) |
HaloTag ORF Clone |
FHC02017
![]() |
Flexi ORF Clone | FXC02017 |
Source | Human adult brain |
Rouge ID |
mKIAA1091
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 167 bp |
---|---|
Genome contig ID | gi51511727r_9017627 |
PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | r | 9117627 | 9243409 | 23 | 99.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR005113 | 84 | 210 | PF03456 | uDENN |
IPR001194 | 274 | 462 | PF02141 | DENN | |
IPR005112 | 584 | 660 | PF03455 | dDENN | |
IPR004012 | 881 | 1018 | PF02759 | RUN | |
IPR001024 | 1029 | 1131 | PF01477 | Lipoxygenase | |
HMMSmart | IPR005113 | 84 | 210 | SM00800 | uDENN |
IPR001194 | 274 | 462 | SM00799 | DENN | |
IPR005112 | 584 | 660 | SM00801 | dDENN | |
IPR004012 | 956 | 1019 | SM00593 | RUN | |
IPR004012 | 1290 | 1350 | SM00593 | RUN | |
ProfileScan | IPR005113 | 84 | 216 | PS50946 | uDENN |
IPR001194 | 274 | 462 | PS50211 | DENN | |
IPR005112 | 584 | 660 | PS50947 | dDENN | |
IPR004012 | 859 | 1022 | PS50826 | RUN | |
IPR001024 | 1026 | 1134 | PS50095 | Lipoxygenase | |
IPR004012 | 1206 | 1354 | PS50826 | RUN |
![]() |
Primer_f | TTCAACATCACGCTGGAGACG |
---|---|
Primer_r | GTCTCCTACTCCTGCACAATC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |