KIAA1091

Product ID	ORK02017
Accession No	AB029014
Description	DENN/MADD domain containing 5A, transcript variant 1
Clone name	hk04373
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4248 bp) Predicted protein sequence (1359 aa)
HaloTag ORF Clone	FHC02017
Flexi ORF Clone	FXC02017
Source	Human adult brain
Rouge ID	mKIAA1091 by Kazusa Mouse cDNA Project

Length: 4248 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	167 bp
Genome contig ID	gi51511727r_9017627
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- AGGATTTTTGGAATAAATAATCTATTTTAGAGTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTGCTGATTTGCTTTTTACACACTTTCATGTGAAAGAGTGATAGGGAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	9117627	9243409	23	99.8	Perfect prediction

Length: 1359 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6IQ26	100.0	DENN domain-con...	Homo sapiens
CAB55932	99.9	hypothetical pr...	Homo sapiens
XP_534048	95.7	similar to RAB6...	Canis lupus fam...
XP_508914	99.7	RAB6 interactin...	Pan troglodytes
Q6PAL8	97.8	DENN domain-con...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051553	3.6e-07	27.4	KIAA1766
AB007945	3.7e-07	24.2	KIAA0476
AB046828	1.6e-06	30.7	KIAA1608
AB033103	2.3e-05	26.7	KIAA1277
AB002356	2.4e-05	24.4	KIAA0358

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005113	84	210	PF03456	uDENN
	IPR001194	274	462	PF02141	DENN
	IPR005112	584	660	PF03455	dDENN
	IPR004012	881	1018	PF02759	RUN
	IPR001024	1029	1131	PF01477	Lipoxygenase
HMMSmart	IPR005113	84	210	SM00800	uDENN
	IPR001194	274	462	SM00799	DENN
	IPR005112	584	660	SM00801	dDENN
	IPR004012	956	1019	SM00593	RUN
	IPR004012	1290	1350	SM00593	RUN
ProfileScan	IPR005113	84	216	PS50946	uDENN
	IPR001194	274	462	PS50211	DENN
	IPR005112	584	660	PS50947	dDENN
	IPR004012	859	1022	PS50826	RUN
	IPR001024	1026	1134	PS50095	Lipoxygenase
	IPR004012	1206	1354	PS50826	RUN

Primer_f	TTCAACATCACGCTGGAGACG
Primer_r	GTCTCCTACTCCTGCACAATC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-