Order Kazusa clone(s) from : ![]() |
Product ID | ORK00878 |
---|---|
Accession No | AB046833 |
Description | solute carrier family 7, member 14 |
Clone name | fj12845 |
Vector information | |
cDNA sequence | DNA sequence (4573 bp) Predicted protein sequence (686 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1613
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2511 bp |
---|---|
Genome contig ID | gi89161205r_171565047 |
PolyA signal sequence (GATAAA,-31) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | r | 171665047 | 171727186 | 7 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR004841 | 4 | 352 | PF00324 | Amino acid permease-associated region |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 6 | GPGVIVSFIIAAVASILSGVCYA | 28 | PRIMARY | 23 | 2 | 51 | EFVAFFIGWNLILEYLIGTAAGA | 73 | PRIMARY | 23 | 3 | 109 | YPDLLALLIAVIVTIIVALGVKN | 131 | PRIMARY | 23 | 4 | 138 | VLNVLNLAVWVFIMIAGLFFIN | 159 | PRIMARY | 22 | 5 | 177 | LQGAATCFYAFIGFDIIATTGE | 198 | SECONDARY | 22 | 6 | 211 | ITASLVICLTAYVSVSVILTLMV | 233 | PRIMARY | 23 | 7 | 260 | VAIGSVAGLTVSLLGSLFPMPRV | 282 | SECONDARY | 23 | 8 | 305 | TPVVACIVSGFLAALLALLVSLR | 327 | PRIMARY | 23 | 9 | 332 | MMSIGTLLAYTLVSVCVLLLRY | 353 | PRIMARY | 22 | 10 | 485 | HTVTICVLLLFILMFIFCSFIIF | 507 | PRIMARY | 23 | 11 | 517 | WWAILLVVLMVLLISTLVFVILQ | 539 | PRIMARY | 23 | 12 | 548 | PYMAPCLPFVPAFAMLVNIYLML | 570 | PRIMARY | 23 | 13 | 575 | ITWIRFAVWCFVGLLIYFGYGIW | 597 | PRIMARY | 23 |
---|
![]() |
Primer_f | GGCAAAATCTTAACGTGGGTG |
---|---|
Primer_r | ACTATGTGGGAAAAATGGCTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |