Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00475 |
---|---|
Accession No | D87432 |
Description | solute carrier family 7 (amino acid transporter light chain, y+L system), member 6, transcript variant 2 |
Clone name | ha07016 |
Vector information | |
cDNA sequence | DNA sequence (6296 bp) Predicted protein sequence (552 aa) |
HaloTag ORF Clone |
FHC00475
|
Flexi ORF Clone | FXC00475 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0245
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 4487 bp |
---|---|
Genome contig ID | gi51511732f_66757995 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (135230 - 135279) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 16 | f | 66857995 | 66893223 | 11 | 99.3 | Terminal No-hit |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR004841 | 86 | 519 | PF00324 | Amino acid permease-associated region |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 83 | SLLNGVSLVVGNMIGSGIFVSPK | 105 | SECONDARY | 23 | 2 | 115 | GMSLIVWAIGGLFSVVGALCYAE | 137 | PRIMARY | 23 | 3 | 159 | FIAFIRLWVSLLVVEPTGQAIIA | 181 | PRIMARY | 23 | 4 | 201 | LACRLLAAACICLLTFVNCAYVK | 223 | PRIMARY | 23 | 5 | 232 | FTYAKVVALIAIIVMGLVKLCQG | 254 | PRIMARY | 23 | 6 | 313 | PIVTLIYILTNVAYYTVLNISDV | 335 | PRIMARY | 23 | 7 | 357 | IPIAVALSCFGGLNASIFASSRL | 379 | SECONDARY | 23 | 8 | 403 | PIPALLFNCTMALIYLIVEDVFQ | 425 | PRIMARY | 23 | 9 | 460 | KLSVFFPIVFCICSVFLVIVPLF | 482 | PRIMARY | 23 | 10 | 486 | INSLIGIGIALSGVPFYFMGVY | 507 | PRIMARY | 22 |
---|
Panel name | Genebridge 4 |
---|---|
Primer_f | CCTTCACACTGGAGTATTTTG |
Primer_r | TTGCATATTCTTTTGGGGAGG |
PCR product length | 170 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |