Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01632 |
---|---|
Accession No | AB046843 |
Description | anoctamin 8 |
Clone name | fj04650 |
Vector information | |
cDNA sequence | DNA sequence (4150 bp) Predicted protein sequence (1236 aa) |
HaloTag ORF Clone |
FHC01632
|
Flexi ORF Clone | FXC01632 |
Source | Human fetal brain |
Rouge ID |
mKIAA1623
by Kazusa Mouse cDNA Project
|
Note | We replaced hk07620, former representative clones for KIAA1623 with fj04650. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 292 bp |
---|---|
Genome contig ID | gi42406306r_17195034 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | r | 17295034 | 17306638 | 18 | 99.6 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR007632 | 475 | 884 | PF04547 | Protein of unknown function DUF590 |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 364 | SLPLCLACLVCVFLLMLGCFQLQ | 386 | PRIMARY | 23 | 2 | 397 | RLARFLPKVMLALLVSVSAEGY | 418 | SECONDARY | 22 | 3 | 441 | LIIKVVLFQFVNSYLSLFYIGFY | 463 | SECONDARY | 23 | 4 | 760 | GYVVLFSSAFPLAALCALVNNLI | 782 | PRIMARY | 23 | 5 | 811 | KVMEAMGVLAIVVNCYLIGQCGQ | 833 | PRIMARY | 23 | 6 | 845 | AAIVSVVVLEHFALLLKYLIHVA | 867 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | TCCTCAAGTACCTCATCCACG |
---|---|
Primer_r | TGGCGCTCGTGTCTCTTAAAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | RH-map |
---|---|
Primer_f | TTCCTCAAACTGTCCTCCCCC |
Primer_r | GGGCATCCAGGCACATAAAGG |
PCR product length | 136 bp |
PCR conditions | 95 °C15 sec66 °C60 sec35 cycles |