| 
Order Kazusa clone(s) from :  | 
| Product ID | ORK04691 | 
|---|---|
| Accession No | AB051463 | 
| Description | tet methylcytosine dioxygenase 1 | 
| Clone name | fh07095 | 
| Vector information | |
| cDNA sequence | DNA sequence (4834 bp) Predicted protein sequence (735 aa)  | 
| Source | Human fetal brain | 
| Rouge ID | 
    mKIAA1676
    
    by Kazusa Mouse cDNA Project
     | 
 Length: 4834 bp
 Physical map
    
 Restriction map
 Prediction of protein coding region (GeneMark analysis).
    | N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | Warning | 
 Integrity of 3' end
    | Length of 3'UTR | 2626 bp | 
|---|---|
| Genome contig ID | gi89161187f_69976696 | 
| PolyA signal sequence (AATAAA,-31)  | 
            +----*----+----*----+----*----+----  | 
        
| Flanking genome sequence (147550 - 147599)  | 
            ----+----*----+----*----+----*----+----*----+----*  | 
        
  
 Ensembl ContigView  (Add our DAS server as a DAS source)
  
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
| 
 | 10 | f | 70076696 | 70124244 | 10 | 99.4 | Perfect prediction | 
 
        Length: 735 aa
        Result of homology search against nr database 
        (FASTA output,
	Multiple alignment)![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
        Result of homology search against HUGE database
        (FASTA output,
	Multiple alignment)The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
	Result of motif / domain search (InterProScan and SOSUI)
 Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition | 
|---|---|---|---|---|---|
| None | - | - | - | - | - | 
	Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 105 | TGHHCPTAVMVVLIMVWDGIPLP | 127 | PRIMARY | 23 | 
|---|
           
	  RT-PCR-ELISA
	   | 
          
	  
 Experimental conditions| Primer_f | TGACGCTTGTTGCAGTTTACC | 
|---|---|
| Primer_r | AAATCACAGGGCAGAGAATGG | 
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]()  | 
 Chromosome No. 10 
 Experimental conditions| Panel name | GeneBridge 4 | 
|---|---|
| Primer_f | TTAATACGGAAATCGCTGTGG | 
| Primer_r | TAACCTCCAAATCGGCTTCTC | 
| PCR product length | 169 bp | 
| PCR conditions | 95 °C 15 sec 62 °C 60 sec 30 cycles |