KIAA1676

Product ID	ORK04691
Accession No	AB051463
Description	tet methylcytosine dioxygenase 1
Clone name	fh07095
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4834 bp) Predicted protein sequence (735 aa)
Source	Human fetal brain
Rouge ID	mKIAA1676 by Kazusa Mouse cDNA Project

Length: 4834 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	2626 bp
Genome contig ID	gi89161187f_69976696
PolyA signal sequence (AATAAA,-31)	+--------+--------+----*----+---- AGGAAATAAATTTGTTTGAAATGACATTTTCTCTC
Flanking genome sequence (147550 - 147599)	----+--------+--------+--------+--------+----* ATAAAACTGGTCATCTAACATTATTTCTACCCCTCTATTATGTTTTACTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	70076696	70124244	10	99.4	Perfect prediction

Length: 735 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8NFU7	100.0	Protein TET1; T...	Homo sapiens
AAM88301	100.0	leukemia-associ...	Homo sapiens
EAW54299	100.0	CXXC finger 6 [...	Homo sapiens
XP_507822	99.5	CXXC finger 6 [...	Pan troglodytes
XP_536371	89.0	similar to CXXC...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046766	6.9e-20	35.0	KIAA1546

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	105	TGHHCPTAVMVVLIMVWDGIPLP	127	PRIMARY	23

Primer_f	TGACGCTTGTTGCAGTTTACC
Primer_r	AAATCACAGGGCAGAGAATGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TTAATACGGAAATCGCTGTGG
Primer_r	TAACCTCCAAATCGGCTTCTC
PCR product length	169 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles