KIAA1546

Product ID	ORK05674
Accession No	AB046766
Description	tet methylcytosine dioxygenase 2
Clone name	fh12289
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5351 bp) Predicted protein sequence (684 aa)
Source	Human fetal brain
Rouge ID	mKIAA1546 by Kazusa Mouse cDNA Project

Length: 5351 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3295 bp
Genome contig ID	gi89161207f_106302364
PolyA signal sequence (AATAAA,-30)	+--------+--------+----*----+---- TTTTTAATAAAATTTATATTTATTTAATGCACTCT
Flanking genome sequence (118045 - 118094)	----+--------+--------+--------+--------+----* AAGTGTTGTCTTCCTGAAGTTTTTTTAGTGCTTGAATGACTGCCACCTCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	106402364	106420407	4	99.1	Perfect prediction

Length: 684 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX06179	100.0	hCG21336 [Homo ...	Homo sapiens
AAI10511	99.9	TET2 protein [H...	Homo sapiens
NP_001120680	100.0	tet oncogene fa...	Homo sapiens
Q6N021	99.9	Protein TET2.	Homo sapiens
XP_526645	99.3	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051463	2e-17	35.1	KIAA1676
AB007861	9.1e-05	45.0	KIAA0401

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	CCCTTTTGTTGGTTACCTCAC
Primer_r	GAGCCAGTGAAAATTAAGTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-