| 
Order Kazusa clone(s) from :  | 
| Product ID | ORK00888 | 
|---|---|
| Accession No | AB051478 | 
| Description | tweety family member 3 | 
| Clone name | fj00597s1 | 
| Vector information | |
| cDNA sequence | DNA sequence (4816 bp) Predicted protein sequence (558 aa)  | 
| 
    
     
    HaloTag ORF Clone  | 
    
    
    
     
    FHC00888
     
     
     | 
| Flexi ORF Clone | FXC00888 | 
| Source | Human fetal brain | 
| Rouge ID | 
    mKIAA1691
    
    by Kazusa Mouse cDNA Project
     | 
| Note | We replaced fj00597, former representative clones for KIAA1691 with fj00597s1. (2002/5/10) | 
 Length: 4816 bp
 Physical map
    
 Restriction map
 Prediction of protein coding region (GeneMark analysis).
    | N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning | 
 Integrity of 3' end
    | Length of 3'UTR | 3062 bp | 
|---|---|
| Genome contig ID | gi89161213f_2538194 | 
| PolyA signal sequence (AATAAA,-17)  | 
            +----*----+----*----+----*----+----  | 
        
| Flanking genome sequence (132768 - 132817)  | 
            ----+----*----+----*----+----*----+----*----+----*  | 
        
  
 Ensembl ContigView  (Add our DAS server as a DAS source)
  
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
| 
 | 7 | f | 2638134 | 2670960 | 14 | 99.3 | Perfect prediction | 
 
        Length: 558 aa
        Result of homology search against nr database 
        (FASTA output,
	Multiple alignment)![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
        Result of homology search against HUGE database
        (FASTA output,
	Multiple alignment)
	Result of motif / domain search (InterProScan and SOSUI)
 Result of InterProScan
	Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 32 | PGPAMAGVSYAAPWWVSLLHRLP | 54 | SECONDARY | 23 | 2 | 78 | LLLLGAAALACLALDLLFLLFYS | 100 | PRIMARY | 23 | 3 | 118 | CCCTAWCVIIATLVCSAGIAVG | 139 | PRIMARY | 22 | 4 | 210 | LETLLGYTAAIPFWRNTAVSLEV | 232 | SECONDARY | 23 | 5 | 244 | RWLGYLGLLLLDVIICLLVLVGL | 266 | PRIMARY | 23 | 6 | 275 | VGVCLLGVLALVISWGALGLELA | 297 | PRIMARY | 23 | 7 | 423 | LIYLALFSFVTALMFSSIVCSVP | 445 | PRIMARY | 23 | 
|---|
           
	  RT-PCR-ELISA
	   | 
          
	  
 Experimental conditions| Primer_f | CTGAGGCCTGAACCATTTTGC | 
|---|---|
| Primer_r | CCCAAGCTGAATAGAAACCAC | 
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]()  | 
 Chromosome No. 7 
 Experimental conditions| Panel name | unigene | 
|---|---|
| Primer_f | - | 
| Primer_r | - | 
| PCR product length | - | 
| PCR conditions | - |