Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00888 |
---|---|
Accession No | AB051478 |
Description | tweety family member 3 |
Clone name | fj00597s1 |
Vector information | |
cDNA sequence | DNA sequence (4816 bp) Predicted protein sequence (558 aa) |
HaloTag ORF Clone |
FHC00888
|
Flexi ORF Clone | FXC00888 |
Source | Human fetal brain |
Rouge ID |
mKIAA1691
by Kazusa Mouse cDNA Project
|
Note | We replaced fj00597, former representative clones for KIAA1691 with fj00597s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3062 bp |
---|---|
Genome contig ID | gi89161213f_2538194 |
PolyA signal sequence (AATAAA,-17) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (132768 - 132817) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | f | 2638134 | 2670960 | 14 | 99.3 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 32 | PGPAMAGVSYAAPWWVSLLHRLP | 54 | SECONDARY | 23 | 2 | 78 | LLLLGAAALACLALDLLFLLFYS | 100 | PRIMARY | 23 | 3 | 118 | CCCTAWCVIIATLVCSAGIAVG | 139 | PRIMARY | 22 | 4 | 210 | LETLLGYTAAIPFWRNTAVSLEV | 232 | SECONDARY | 23 | 5 | 244 | RWLGYLGLLLLDVIICLLVLVGL | 266 | PRIMARY | 23 | 6 | 275 | VGVCLLGVLALVISWGALGLELA | 297 | PRIMARY | 23 | 7 | 423 | LIYLALFSFVTALMFSSIVCSVP | 445 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | CTGAGGCCTGAACCATTTTGC |
---|---|
Primer_r | CCCAAGCTGAATAGAAACCAC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |