Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00890 |
---|---|
Accession No | AB051488 |
Description | basic helix-loop-helix domain containing, class B, 9, transcript variant 2 |
Clone name | fj15383 |
Vector information | |
cDNA sequence | DNA sequence (3827 bp) Predicted protein sequence (570 aa) |
HaloTag ORF Clone |
FHC00890
|
Flexi ORF Clone | FXC00890 |
Source | Human fetal brain |
Rouge ID |
mKIAA1701
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1800 bp |
---|---|
Genome contig ID | gi89161218f_101789410 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (104614 - 104663) |
----+----*----+----*----+----*----+----*----+----* |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RT-PCR-ELISA |
Primer_f | AGCATTCCCAGGACATTTAGG |
---|---|
Primer_r | TATACAGTGGGGGGAAGCAAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |