Gene/Protein Characteristic Table for KIAA1706
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00892
Accession No AB051493
Description endonuclease/exonuclease/phosphatase family domain containing 1
Clone name fj17179
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4427 bp)
Predicted protein sequence (573 aa)
Flexi ORF Clone FXC00892
Source Human fetal brain
Rouge ID mKIAA1706 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4427 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 2336 bp
Genome contig ID gi89161213f_36059620
PolyA signal sequence
(ATTAAA,-31)
+----*----+----*----+----*----+----
TTATATTAAAGTTCACTCTTTGTGTTGTGCATCCT
Flanking genome sequence
(248058 - 248107)
----+----*----+----*----+----*----+----*----+----*
ATGGGTTTTGACAAATGTAGAATGACATGTATCACCATGCTACAGAATCA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 7 f 36159620 36307676 8 99.4 Perfect prediction
Features of the protein sequence
Description

Length: 573 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
NP_085139 0 99.8 endonuclease/ex...
Homo sapiens
XP_001103689 0 98.4 hypothetical pr...
Macaca mulatta
XP_001501241 0 94.0 similar to endo...
Equus caballus
Q3MHJ7 0 93.2 Endonuclease/ex...
Bos taurus
Q5XI74 1e-216 91.0 Endonuclease/ex...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000445 42 71 PF00633 Helix-hairpin-helix motif
IPR005135 265 542 PF03372 Endonuclease/exonuclease/phosphatase
HMMSmart IPR003583 52 71 SM00278 Helix-hairpin-helix DNA-binding
IPR003583 82 101 SM00278 Helix-hairpin-helix DNA-binding
IPR003583 149 168 SM00278 Helix-hairpin-helix DNA-binding
HMMTigr IPR004509 42 104 TIGR00426 Competence protein ComEA helix-hairpin-helix region
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ACCCTTGTTAACCTTCACCTG
Primer_r TCATAGTCATTGCTGTCTGGC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 7
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp