KIAA1707

Product ID	ORK06765
Accession No	AB051494
Description	SUMO1/sentrin specific peptidase 7
Clone name	fj17662
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3938 bp) Predicted protein sequence (756 aa)
Source	Human fetal brain
Rouge ID	mKIAA1707 by Kazusa Mouse cDNA Project

Length: 3938 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1667 bp
Genome contig ID	gi89161205r_102425810
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- TCAGTGTTTTATATTAAACATATTTCCAATTCATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATTGAGGTGTAATTTTTTTCCTTAAGAAACATGAGCTACTGTTAGAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	102525810	102569459	17	99.5	Perfect prediction

Length: 756 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW79802	100.0	SUMO1/sentrin s...	Homo sapiens
EAW79800	100.0	SUMO1/sentrin s...	Homo sapiens
EAW79799	100.0	SUMO1/sentrin s...	Homo sapiens
EAW79798	100.0	SUMO1/sentrin s...	Homo sapiens
EAW79801	100.0	SUMO1/sentrin s...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018340	7.1e-23	29.9	KIAA0797

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003653	466	742	PF02902	Peptidase C48
ProfileScan	IPR003653	466	709	PS50600	Peptidase C48

Primer_f	CAACTTGTTCTTTCCCTGCTG
Primer_r	ATAGAAAGGGAGTAGCAACCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-