KIAA1709

Product ID	ORK00893
Accession No	AB051496
Description	N-acetyltransferase 10 (GCN5-related), transcript variant 1
Clone name	fj18302
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3954 bp) Predicted protein sequence (1028 aa)
HaloTag ORF Clone	FHC00893
Flexi ORF Clone	FXC00893
Source	Human fetal brain
Rouge ID	mKIAA1709 by Kazusa Mouse cDNA Project

Length: 3954 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	711 bp
Genome contig ID	gi51511727f_33983766
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- GATAGAGAATCTATTTTTAATAAATAACATTCTAG
Flanking genome sequence (141262 - 141311)	----+--------+--------+--------+--------+----* AAAGATCAGCTGCCTGTGAGTGTTCTGAAATCCACGCACCTGGACGTTTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	34083766	34125026	29	99.9	Perfect prediction

Length: 1028 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9H0A0	100.0	N-acetyltransfe...	Homo sapiens
BAB13995	99.8	unnamed protein...	Homo sapiens
XP_001115674	99.0	N-acetyltransfe...	Macaca mulatta
BAA91800	99.9	unnamed protein...	Homo sapiens
AAI40654	96.5	NAT10 protein [...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013562	110	204	PF08351	Domain of unknown function DUF1726
	IPR007807	283	491	PF05127	Protein of unknown function DUF699
	IPR000182	627	658	PF00583	GCN5-related N-acetyltransferase
ProfileScan	IPR000182	561	756	PS51186	GCN5-related N-acetyltransferase

Primer_f	CTCTCTTTGTGGACTTGTACC
Primer_r	ACATAAACTACAGGATCAGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-