KIAA1721

Gene/Protein Characteristic Table for KIAA1721

Order Kazusa clone(s) from :

Product ID	ORK00900
Accession No	AB051508
Description	exportin 4
Clone name	pf00531
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (8047 bp) Predicted protein sequence (1150 aa)
HaloTag ORF Clone	FHC00900
Flexi ORF Clone	FXC00900
Source	Human brain (hippocampus)
Rouge ID	mKIAA1721 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 8047 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4592 bp
Genome contig ID	gi51511729r_20151311
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- TTTTAAATTTATAAATATTAAAATTTTAAACTTAC
Flanking genome sequence (99958 - 99909)	----+--------+--------+--------+--------+----* ACTAAGACTTTTCAGTTTTATTTAAAGACCCAGGGATGAGTGTACTGTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	13	r	20251269	20374876	23	99.4	Perfect prediction

Features of the protein sequence

Description

Length: 1150 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9C0E2	100.0	Exportin-4; Sho...	Homo sapiens
XP_001085699	99.7	exportin 4 [Mac...	Macaca mulatta
Q9ESJ0	98.5	Exportin-4; Sho...	Mus musculus
XP_001489040	98.3	exportin 4 [Equ...	Equus caballus
EDM14355	98.0	exportin 4 (pre...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	AACAGTTACTTGCTTCACCGG
Primer_r	TTTCTGGAGGTATTAGCGGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 13

Experimental conditions

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp