KIAA1729

Product ID	ORK07485
Accession No	AB051516
Description	zinc finger protein 518B
Clone name	pg00954
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6295 bp) Predicted protein sequence (1020 aa)
Source	Human brain (hippocampus)
Rouge ID	mKIAA1729 by Kazusa Mouse cDNA Project

Length: 6295 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3231 bp
Genome contig ID	gi89161207r_9950603
PolyA signal sequence (AATAAA,-32)	+--------+--------+----*----+---- TTAAATAAAGCAACAAAAATTTTCTTTGCCCTTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTCAAACGTTATGCAGGTGACTTTATTACATAGCCTATTTGTATTATA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	r	10050603	10056889	1	99.0	Perfect prediction

Length: 1020 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW92691	99.9	hCG2026767 [Hom...	Homo sapiens
Q9C0D4	99.8	Zinc finger pro...	Homo sapiens
XP_001098027	95.9	similar to plei...	Macaca mulatta
XP_001501034	80.8	zinc finger pro...	Equus caballus
NP_001124305	80.3	zinc finger pro...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002333	8.4e-08	24.5	KIAA0335

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	136	159	PF00096	Zinc finger
HMMSmart	IPR015880	81	103	SM00355	Zinc finger
	IPR015880	108	130	SM00355	Zinc finger
	IPR015880	136	159	SM00355	Zinc finger
	IPR015880	982	1004	SM00355	Zinc finger
ProfileScan	IPR007087	108	135	PS50157	Zinc finger
ScanRegExp	IPR007087	984	1004	PS00028	Zinc finger

Primer_f	GGTTTTGTGGGCGACTGTATG
Primer_r	ACTGAATCTTGGTGGAGGGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-