Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK07485 |
---|---|
Accession No | AB051516 |
Description | zinc finger protein 518B |
Clone name | pg00954 |
Vector information | |
cDNA sequence | DNA sequence (6295 bp) Predicted protein sequence (1020 aa) |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA1729
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3231 bp |
---|---|
Genome contig ID | gi89161207r_9950603 |
PolyA signal sequence (AATAAA,-32) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 4 | r | 10050603 | 10056889 | 1 | 99.0 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR007087 | 136 | 159 | PF00096 | Zinc finger |
HMMSmart | IPR015880 | 81 | 103 | SM00355 | Zinc finger |
IPR015880 | 108 | 130 | SM00355 | Zinc finger | |
IPR015880 | 136 | 159 | SM00355 | Zinc finger | |
IPR015880 | 982 | 1004 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 108 | 135 | PS50157 | Zinc finger |
ScanRegExp | IPR007087 | 984 | 1004 | PS00028 | Zinc finger |
RT-PCR-ELISA |
Primer_f | GGTTTTGTGGGCGACTGTATG |
---|---|
Primer_r | ACTGAATCTTGGTGGAGGGAC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |