KIAA0335

Product ID	ORK01665
Accession No	AB002333
Description	zinc finger protein 518A, transcript variant 2
Clone name	pf00495
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (8147 bp) Predicted protein sequence (1484 aa)
HaloTag ORF Clone	FHC01665
Flexi ORF Clone	FXC01665
Source	Human brain (hippocampus)
Rouge ID	mKIAA0335 by Kazusa Mouse cDNA Project
Note	We replaced hg01070, former representative clones for KIAA0335 with pf00495. (2002/5/10)

Length: 8147 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2864 bp
Genome contig ID	gi89161187f_97805150
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GTTAGCCAATTTTTTCAATAAAGGGTCAGATAAAT
Flanking genome sequence (108236 - 108285)	----+--------+--------+--------+--------+----* AAGCTTCGTAGGCCTTCTAGTTTCTGTCCTAACTACTCAATTCTCATAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	97905090	97913384	2	99.0	Perfect prediction

Length: 1484 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6AHZ1	100.0	Zinc finger pro...	Homo sapiens
CAH10523	99.9	hypothetical pr...	Homo sapiens
XP_001100415	96.0	similar to zinc...	Macaca mulatta
XP_001501837	85.0	similar to Zinc...	Equus caballus
XP_001928172	83.3	similar to Zinc...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051516	7.6e-09	24.0	KIAA1729
AB075862	8.5e-06	24.7	KIAA1982
AB058732	1.5e-05	28.6	KIAA1829
AB075849	1.7e-05	23.6	KIAA1969
AB007886	1.7e-05	23.8	KIAA0426

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	263	286	PF00096	Zinc finger
HMMSmart	IPR015880	120	145	SM00355	Zinc finger
	IPR015880	151	173	SM00355	Zinc finger
	IPR015880	178	202	SM00355	Zinc finger
	IPR015880	208	230	SM00355	Zinc finger
	IPR015880	235	257	SM00355	Zinc finger
	IPR015880	263	286	SM00355	Zinc finger
	IPR015880	1450	1472	SM00355	Zinc finger
ProfileScan	IPR007087	235	262	PS50157	Zinc finger
ProfileScan	IPR007087	1450	1477	PS50157	Zinc finger
ScanRegExp	IPR007087	237	257	PS00028	Zinc finger
ScanRegExp	IPR007087	1452	1472	PS00028	Zinc finger

Primer_f	CATTTGGGGACCTACTGTTAC
Primer_r	TTCAGTTTAGTTCAGTGCATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CATTTGGGGACCTACTGTTAC
Primer_r	TTCAGTTTAGTTCAGTGCATG
PCR product length	222 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles