Order Kazusa clone(s) from : ![]() |
Product ID | ORK00960 |
---|---|
Accession No | AB075849 |
Description | zinc finger protein 431 |
Clone name | fk06944 |
Vector information | |
cDNA sequence | DNA sequence (3146 bp) Predicted protein sequence (595 aa) |
HaloTag ORF Clone |
FHC00960
![]() |
Flexi ORF Clone | FXC00960 |
Source | Human fetal brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1307 bp |
---|---|
Genome contig ID | gi42406306f_20972831 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (187154 - 187203) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | f | 21116719 | 21159983 | 5 | 99.1 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 251 | 274 | PD000003 | Zinc finger |
IPR007087 | 279 | 302 | PD000003 | Zinc finger | |
IPR007087 | 307 | 330 | PD000003 | Zinc finger | |
IPR007087 | 335 | 357 | PD000003 | Zinc finger | |
IPR007087 | 363 | 386 | PD000003 | Zinc finger | |
IPR007087 | 391 | 414 | PD000003 | Zinc finger | |
IPR007087 | 419 | 442 | PD000003 | Zinc finger | |
IPR007087 | 447 | 470 | PD000003 | Zinc finger | |
IPR007087 | 475 | 498 | PD000003 | Zinc finger | |
IPR007087 | 503 | 526 | PD000003 | Zinc finger | |
IPR007087 | 531 | 554 | PD000003 | Zinc finger | |
HMMPfam | IPR001909 | 54 | 94 | PF01352 | KRAB box |
IPR007087 | 223 | 245 | PF00096 | Zinc finger | |
IPR007087 | 251 | 273 | PF00096 | Zinc finger | |
IPR007087 | 279 | 301 | PF00096 | Zinc finger | |
IPR007087 | 307 | 329 | PF00096 | Zinc finger | |
IPR007087 | 335 | 357 | PF00096 | Zinc finger | |
IPR007087 | 363 | 385 | PF00096 | Zinc finger | |
IPR007087 | 391 | 413 | PF00096 | Zinc finger | |
IPR007087 | 419 | 441 | PF00096 | Zinc finger | |
IPR007087 | 447 | 469 | PF00096 | Zinc finger | |
IPR007087 | 475 | 497 | PF00096 | Zinc finger | |
IPR007087 | 503 | 525 | PF00096 | Zinc finger | |
IPR007087 | 531 | 553 | PF00096 | Zinc finger | |
HMMSmart | IPR001909 | 54 | 114 | SM00349 | KRAB box |
IPR015880 | 223 | 245 | SM00355 | Zinc finger | |
IPR015880 | 251 | 273 | SM00355 | Zinc finger | |
IPR015880 | 279 | 301 | SM00355 | Zinc finger | |
IPR015880 | 307 | 329 | SM00355 | Zinc finger | |
IPR015880 | 335 | 357 | SM00355 | Zinc finger | |
IPR015880 | 363 | 385 | SM00355 | Zinc finger | |
IPR015880 | 391 | 413 | SM00355 | Zinc finger | |
IPR015880 | 419 | 441 | SM00355 | Zinc finger | |
IPR015880 | 447 | 469 | SM00355 | Zinc finger | |
IPR015880 | 475 | 497 | SM00355 | Zinc finger | |
IPR015880 | 503 | 525 | SM00355 | Zinc finger | |
IPR015880 | 531 | 553 | SM00355 | Zinc finger | |
ProfileScan | IPR001909 | 54 | 125 | PS50805 | KRAB box |
IPR007087 | 195 | 222 | PS50157 | Zinc finger | |
IPR007087 | 223 | 250 | PS50157 | Zinc finger | |
IPR007087 | 251 | 278 | PS50157 | Zinc finger | |
IPR007087 | 279 | 306 | PS50157 | Zinc finger | |
IPR007087 | 307 | 334 | PS50157 | Zinc finger | |
IPR007087 | 335 | 362 | PS50157 | Zinc finger | |
IPR007087 | 363 | 390 | PS50157 | Zinc finger | |
IPR007087 | 391 | 418 | PS50157 | Zinc finger | |
IPR007087 | 419 | 446 | PS50157 | Zinc finger | |
IPR007087 | 447 | 474 | PS50157 | Zinc finger | |
IPR007087 | 475 | 502 | PS50157 | Zinc finger | |
IPR007087 | 503 | 530 | PS50157 | Zinc finger | |
IPR007087 | 531 | 558 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 225 | 245 | PS00028 | Zinc finger |
IPR007087 | 253 | 273 | PS00028 | Zinc finger | |
IPR007087 | 281 | 301 | PS00028 | Zinc finger | |
IPR007087 | 309 | 329 | PS00028 | Zinc finger | |
IPR007087 | 337 | 357 | PS00028 | Zinc finger | |
IPR007087 | 365 | 385 | PS00028 | Zinc finger | |
IPR007087 | 393 | 413 | PS00028 | Zinc finger | |
IPR007087 | 421 | 441 | PS00028 | Zinc finger | |
IPR007087 | 449 | 469 | PS00028 | Zinc finger | |
IPR007087 | 477 | 497 | PS00028 | Zinc finger | |
IPR007087 | 505 | 525 | PS00028 | Zinc finger | |
IPR007087 | 533 | 553 | PS00028 | Zinc finger |
![]() |
Primer_f | TTGGGTGTTGCTGTCTCTAAG |
---|---|
Primer_r | TGCGGAGCCTTTTCTTAACTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |