Gene/Protein Characteristic Table for KIAA1969
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00960
Accession No AB075849
Description zinc finger protein 431
Clone name fk06944
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (3146 bp)
Predicted protein sequence (595 aa)
Flexi ORF Clone FXC00960
Source Human fetal brain
Features of the cloned cDNA sequence
Description

Length: 3146 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 1307 bp
Genome contig ID gi42406306f_20972831
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
ATTTCTTGAAAAATATTACAGATTTTTTGAAAATT
Flanking genome sequence
(187154 - 187203)		 
----+----*----+----*----+----*----+----*----+----*
GAATAATGTCATCATTCAACTCTGAAATTATTTCCTGTTGTTTCTTCATT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 19 f 21116719 21159983 5 99.1 Perfect prediction
Features of the protein sequence
Description

Length: 595 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q8TF32 0 100.0 Zinc finger pro...
 Homo sapiens
AAH40506 0 99.8 Zinc finger pro...
 Homo sapiens
XP_001145538 0 96.6 zinc finger pro...
 Pan troglodytes
EAW84886 3.5e-208 86.9 zinc finger pro...
 Homo sapiens
CAD39077 2e-207 86.7 hypothetical pr...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB040906 3.3e-125 74.0 KIAA1473
AB075862 1.6e-75 51.6 KIAA1982
AB046831 7.4e-74 47.3 KIAA1611
AB058730 8.2e-72 53.1 KIAA1827
AB107355 1.4e-70 43.5 KIAA2033
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 251 274 PD000003 Zinc finger
IPR007087 279 302 PD000003 Zinc finger
IPR007087 307 330 PD000003 Zinc finger
IPR007087 335 357 PD000003 Zinc finger
IPR007087 363 386 PD000003 Zinc finger
IPR007087 391 414 PD000003 Zinc finger
IPR007087 419 442 PD000003 Zinc finger
IPR007087 447 470 PD000003 Zinc finger
IPR007087 475 498 PD000003 Zinc finger
IPR007087 503 526 PD000003 Zinc finger
IPR007087 531 554 PD000003 Zinc finger
HMMPfam IPR001909 54 94 PF01352 KRAB box
IPR007087 223 245 PF00096 Zinc finger
IPR007087 251 273 PF00096 Zinc finger
IPR007087 279 301 PF00096 Zinc finger
IPR007087 307 329 PF00096 Zinc finger
IPR007087 335 357 PF00096 Zinc finger
IPR007087 363 385 PF00096 Zinc finger
IPR007087 391 413 PF00096 Zinc finger
IPR007087 419 441 PF00096 Zinc finger
IPR007087 447 469 PF00096 Zinc finger
IPR007087 475 497 PF00096 Zinc finger
IPR007087 503 525 PF00096 Zinc finger
IPR007087 531 553 PF00096 Zinc finger
HMMSmart IPR001909 54 114 SM00349 KRAB box
IPR015880 223 245 SM00355 Zinc finger
IPR015880 251 273 SM00355 Zinc finger
IPR015880 279 301 SM00355 Zinc finger
IPR015880 307 329 SM00355 Zinc finger
IPR015880 335 357 SM00355 Zinc finger
IPR015880 363 385 SM00355 Zinc finger
IPR015880 391 413 SM00355 Zinc finger
IPR015880 419 441 SM00355 Zinc finger
IPR015880 447 469 SM00355 Zinc finger
IPR015880 475 497 SM00355 Zinc finger
IPR015880 503 525 SM00355 Zinc finger
IPR015880 531 553 SM00355 Zinc finger
ProfileScan IPR001909 54 125 PS50805 KRAB box
IPR007087 195 222 PS50157 Zinc finger
IPR007087 223 250 PS50157 Zinc finger
IPR007087 251 278 PS50157 Zinc finger
IPR007087 279 306 PS50157 Zinc finger
IPR007087 307 334 PS50157 Zinc finger
IPR007087 335 362 PS50157 Zinc finger
IPR007087 363 390 PS50157 Zinc finger
IPR007087 391 418 PS50157 Zinc finger
IPR007087 419 446 PS50157 Zinc finger
IPR007087 447 474 PS50157 Zinc finger
IPR007087 475 502 PS50157 Zinc finger
IPR007087 503 530 PS50157 Zinc finger
IPR007087 531 558 PS50157 Zinc finger
ScanRegExp IPR007087 225 245 PS00028 Zinc finger
IPR007087 253 273 PS00028 Zinc finger
IPR007087 281 301 PS00028 Zinc finger
IPR007087 309 329 PS00028 Zinc finger
IPR007087 337 357 PS00028 Zinc finger
IPR007087 365 385 PS00028 Zinc finger
IPR007087 393 413 PS00028 Zinc finger
IPR007087 421 441 PS00028 Zinc finger
IPR007087 449 469 PS00028 Zinc finger
IPR007087 477 497 PS00028 Zinc finger
IPR007087 505 525 PS00028 Zinc finger
IPR007087 533 553 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TTGGGTGTTGCTGTCTCTAAG
Primer_r TGCGGAGCCTTTTCTTAACTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 19
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp