KIAA1730

Gene/Protein Characteristic Table for KIAA1730

Order Kazusa clone(s) from :

Product ID	ORK01634
Accession No	AB051517
Description	zyg-11 family member B, cell cycle regulator
Clone name	pg01135
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6404 bp) Predicted protein sequence (787 aa)
HaloTag ORF Clone	FHC01634
Flexi ORF Clone	FXC01634
Source	Human brain (hippocampus)
Rouge ID	mKIAA1730 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 6404 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	4024 bp
Genome contig ID	gi89161185f_52864769
PolyA signal sequence (None)	+--------+--------+----*----+---- CTGTTTTCTCCCCAGTCATCTTATTTGGCTATGTT
Flanking genome sequence (199146 - 199195)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAGCGAGAGAGAGAGATGGTGTCTCACTGTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	52964769	53063913	14	99.3	Perfect prediction

Features of the protein sequence

Description

Length: 787 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001139134	100.0	zyg-11 homolog ...	Pan troglodytes
XP_539612	98.5	similar to zyg-...	Canis lupus fam...
Q9C0D3	100.0	Protein zyg-11 ...	Homo sapiens
AAI51364	99.1	ZYG11B protein ...	Bos taurus
BAE38609	98.3	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	GTTAGAGAAAGTGTCCCCATC
Primer_r	TTCTTGGTGACTTGCTATCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 1

Experimental conditions

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp