KIAA1737

Gene/Protein Characteristic Table for KIAA1737

Order Kazusa clone(s) from :

Product ID	ORK00907
Accession No	AB051524
Description	CLOCK-interacting pacemaker
Clone name	pj00125
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4221 bp) Predicted protein sequence (400 aa)
HaloTag ORF Clone	FHC00907
Flexi ORF Clone	FXC00907
Source	Human brain (hippocampus)
Rouge ID	mKIAA1737 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 4221 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2967 bp
Genome contig ID	gi51511730f_76541751
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- GTCAGAGAAAAATAAAAGTCACTTACTTGAAACCT
Flanking genome sequence (111633 - 111682)	----+--------+--------+--------+--------+----* ATTTGGCCTTTTTGCTTTATAACTGCTTAAAAATACTGAGTGAACCTGGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	76641751	76653382	3	99.1	Perfect prediction

Features of the protein sequence

Description

Length: 400 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
ABV48911	1.1e-112	86.7	clock interacti...	Ovis aries
AAH26384	7.2e-111	86.0	RIKEN cDNA 2310...	Mus musculus
BAE28540	7.7e-111	86.0	unnamed protein...	Mus musculus
EDL02913	7.7e-111	86.0	RIKEN cDNA 2310...	Mus musculus
BAE32612	1.4e-110	85.7	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TTACCATGGGCATTTGTTCTC
Primer_r	ATCTTTCTGGTCACCTCCGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 14

Experimental conditions

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp