KIAA1743

Product ID	ORK00908
Accession No	AB051530
Description	DAB2 interacting protein
Clone name	pj01380s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1-1414) was subcloned upstream of the cDNA (1415-5094). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CCCACGCGAA TTCGATT-5' end of cDNA.
cDNA sequence	DNA sequence (5094 bp) Predicted protein sequence (1036 aa)
HaloTag ORF Clone	FHC00908
Flexi ORF Clone	FXC00908
Source	Human brain (hippocampus)
Rouge ID	mKIAA1743 by Kazusa Mouse cDNA Project
Note	We replaced pj01380, former representative clones for KIAA1743 with pj01380s1. (2002/5/10)

Length: 5094 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1983 bp
Genome contig ID	gi89161216f_123459123
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- CAATTAGAAATATTAAAGATTTATTTAGCTATTTT
Flanking genome sequence (128507 - 128556)	----+--------+--------+--------+--------+----* AAGCCCGACTCGTGTCTCCATTCAGCTGTGTGTTAAGGGATGACCCTGAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	123559123	123587628	14	100.0	Perfect prediction

Length: 1036 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAQ10386	100.0	DAB2 interactin...	Homo sapiens
EAW87504	100.0	DAB2 interactin...	Homo sapiens
EAW87502	100.0	DAB2 interactin...	Homo sapiens
AAK50336	100.0	nGAP-like prote...	Homo sapiens
EAW87501	100.0	DAB2 interactin...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067525	2.9e-35	50.0	KIAA1938

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	29	78	PF00169	Pleckstrin-like
	IPR000008	91	171	PF00168	C2 calcium-dependent membrane targeting
	IPR001936	268	439	PF00616	Ras GTPase-activating protein
HMMSmart	IPR000008	90	186	SM00239	C2 calcium-dependent membrane targeting
HMMSmart	IPR001936	196	533	SM00323	Ras GTPase-activating protein
ProfileScan	IPR001849	1	78	PS50003	Pleckstrin-like
ProfileScan	IPR001936	247	439	PS50018	Ras GTPase-activating protein
ScanRegExp	IPR001936	395	409	PS00509	Ras GTPase-activating protein

Primer_f	ACGCGCAGTTGTTAGAAGACG
Primer_r	TCATACTCCTCCAGCTTCTTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-