KIAA1750

Product ID	ORK00910
Accession No	AB051537
Description	TSPY-like 5
Clone name	pj02374
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4414 bp) Predicted protein sequence (431 aa)
HaloTag ORF Clone	FHC00910
Flexi ORF Clone	FXC00910
Source	Human brain (hippocampus)
Rouge ID	mKIAA1750 by Kazusa Mouse cDNA Project

Length: 4414 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3117 bp
Genome contig ID	gi51511724r_98254878
PolyA signal sequence (None)	+--------+--------+----*----+---- TAAAAACCTGTATCTCTGTTATATTTCTGATTTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAGAATTGGAAGGTTTTTAAACAGAGGCTGGGCAGCTGAGAGAATA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	r	98354878	98359291	1	99.0	Perfect prediction

Length: 431 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW91759	4.5e-156	100.0	TSPY-like 5 [Ho...	Homo sapiens
XP_519872	6.9e-154	99.1	TSPY-like 5 [Pa...	Pan troglodytes
Q86VY4	1.8e-151	100.0	Testis-specific...	Homo sapiens
AAH45630	2e-151	99.8	TSPY-like 5 [Ho...	Homo sapiens
XP_001092365	1.8e-149	98.6	similar to TSPY...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018264	7.3e-31	42.9	KIAA0721

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002164	216	404	PF00956	Nucleosome assembly protein (NAP)

Primer_f	GTAGCTGAGAACTTGGCACTG
Primer_r	TCTATGACATGGCTGCCTTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-