Gene/Protein Characteristic Table for KIAA0721
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00118
Accession No AB018264
Description TSPY-like 4
Clone name hk01908
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4098 bp)
Predicted protein sequence (433 aa)
Flexi ORF Clone FXC00118
Source Human adult brain
Rouge ID mKIAA0721 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4098 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 433 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
CAB55881 5.8e-161 100.0 NAP (Nucleosome...
Homo sapiens
XP_518704 1.6e-158 99.1 TSPY-like 4 [Pa...
Pan troglodytes
Q9UJ04 5.3e-154 100.0 Testis-specific...
Homo sapiens
BAB41148 2.1e-147 96.4 hypothetical pr...
Macaca fascicularis
XP_001502707 6.7e-126 83.1 similar to TSPY...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB051537 1.1e-29 42.9 KIAA1750
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002164 220 410 PF00956 Nucleosome assembly protein (NAP)
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CTGAGGGTTTAGGAGGTCTGA
Primer_r TCCTGTGAGCCTTTCCAAACC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 6
Experimental conditions
Panel name GeneBridge 4
Primer_f CTGAGGGTTTAGGAGGTCTGA
Primer_r TCCTGTGAGCCTTTCCAAACC
PCR product length 120 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp