KIAA1754

Product ID	ORK00912
Accession No	AB051541
Description	inositol 1,4,5-trisphosphate receptor interacting protein, transcript variant 1
Clone name	pj02616
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4088 bp) Predicted protein sequence (594 aa)
HaloTag ORF Clone	FHC00912
Flexi ORF Clone	FXC00912
Source	Human brain (hippocampus)
Rouge ID	mKIAA1754 by Kazusa Mouse cDNA Project

Length: 4088 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	2272 bp
Genome contig ID	gi89161187r_105961884
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- TTATATTAAAGGAAGAATTAAATCTTGCAAGGAGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGAAATGGTCACTGTTTGTTTTTAACTTCAGGAAATCTGTGAGGCTCCCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	106061884	106088152	2	99.0	Perfect prediction

Length: 594 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
A7MB64	4.8e-205	86.1	Inositol 1,4,5-...	Bos taurus
XP_852139	8.9e-205	87.0	hypothetical pr...	Canis lupus fam...
XP_574685	3e-194	80.3	hypothetical pr...	Rattus norvegicus
Q3TNL8	6.5e-185	77.8	Inositol 1,4,5-...	Mus musculus
BAE42729	1.4e-184	77.6	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	129	TRVAWDLWSTLCMILFLMIEVW	150	PRIMARY	22

Primer_f	ATGACTCGGACCTGTACTTTG
Primer_r	TGCCTTTAGTGTCGTCCTGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-