KIAA1818

Gene/Protein Characteristic Table for KIAA1818

Order Kazusa clone(s) from :

Product ID	ORK04900
Accession No	AB058721
Description	E1A binding protein p400
Clone name	hg00622
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6267 bp) Predicted protein sequence (1157 aa)
Source	Human adult brain

Features of the cloned cDNA sequence

Description

Length: 6267 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2793 bp
Genome contig ID	gi89161190f_130982598
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- AAGGCAAAATAAAGTGACCTTTTTATATATTTTTT
Flanking genome sequence (148368 - 148417)	----+--------+--------+--------+--------+----* CATTTTGTCTTTCATAGAAAACTGGTATTTAAGTTAAATGAGATGCTGAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	131082598	131130964	24	99.9	Perfect prediction

Features of the protein sequence

Description

Length: 1157 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10081	100.0	E1A binding pro...	synthetic construct
Q96L91	100.0	E1A-binding pro...	Homo sapiens
NP_056224	99.9	E1A binding pro...	Homo sapiens
AAK97789	99.6	p400 SWI2/SNF2-...	Homo sapiens
XP_001105690	98.2	similar to E1A ...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR001005	357	426	PS50090	SANT

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	ACTGTCAGACTCTAATTGGCG
Primer_r	TGTCTTATCAGGCACCAAATC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 12

Experimental conditions

Panel name	GeneBridge 4
Primer_f	ACTGTCAGACTCTAATTGGCG
Primer_r	TGTCTTATCAGGCACCAAATC
PCR product length	95 bp
PCR conditions	15 °C62 sec60 °C30 sec169 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp