KIAA1824

Product ID	ORK02056
Accession No	AB058727
Description	DDB1 and CUL4 associated factor 5, transcript variant 1
Clone name	fh17057
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5814 bp) Predicted protein sequence (958 aa)
HaloTag ORF Clone	FHC02056
Flexi ORF Clone	FXC02056
Source	Human fetal brain
Rouge ID	mKIAA1824 by Kazusa Mouse cDNA Project

Length: 5814 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2931 bp
Genome contig ID	gi51511730r_68487395
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CTCTTGTGTATATGCAAATAAACCTATTATTCACT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TCTCACGTCTTCCTCTTCTCTTCCAGGGAAGACTTGGTTGCTTAGACACC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	r	68587395	68689502	9	99.2	Perfect prediction

Length: 958 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_510028	99.8	Breakpoint clus...	Pan troglodytes
XP_001104318	98.5	Breakpoint clus...	Macaca mulatta
Q96JK2	100.0	WD repeat-conta...	Homo sapiens
EAW80981	99.9	WD repeat domai...	Homo sapiens
XP_234345	91.6	similar to WD-r...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	65	99	PD000018	WD40 repeat
BlastProDom	IPR001680	157	188	PD000018	WD40 repeat
FPrintScan	IPR001680	85	99	PR00320	WD40 repeat
	IPR001680	174	188	PR00320	WD40 repeat
	IPR001680	311	325	PR00320	WD40 repeat
HMMPfam	IPR001680	59	98	PF00400	WD40 repeat
	IPR001680	107	145	PF00400	WD40 repeat
	IPR001680	148	187	PF00400	WD40 repeat
	IPR001680	300	324	PF00400	WD40 repeat
	IPR001680	339	377	PF00400	WD40 repeat
HMMSmart	IPR001680	58	98	SM00320	WD40 repeat
	IPR001680	106	145	SM00320	WD40 repeat
	IPR001680	148	187	SM00320	WD40 repeat
	IPR001680	195	232	SM00320	WD40 repeat
	IPR001680	280	324	SM00320	WD40 repeat
	IPR001680	338	377	SM00320	WD40 repeat
ProfileScan	IPR001680	65	107	PS50082	WD40 repeat
	IPR001680	65	377	PS50294	WD40 repeat
	IPR001680	154	189	PS50082	WD40 repeat
	IPR001680	345	377	PS50082	WD40 repeat

Primer_f	CTTAGTGAGGAGCAGAATGTG
Primer_r	CTGTTACCTTGAGATGCCTAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-