Order Kazusa clone(s) from : ![]() |
Product ID | ORK00930 |
---|---|
Accession No | AB058738 |
Description | Ran GTPase activating protein 1, transcript variant 2 |
Clone name | fh08795s1 |
Vector information | |
cDNA sequence | DNA sequence (4240 bp) Predicted protein sequence (623 aa) |
HaloTag ORF Clone |
FHC00930
![]() |
Flexi ORF Clone | FXC00930 |
Source | Human fetal brain |
Rouge ID |
mKIAA1835
by Kazusa Mouse cDNA Project
|
Note | We replaced fh08795, former representative clones for KIAA1835 with fh08795s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001611 | 150 | 163 | PR00019 | Leucine-rich repeat |
IPR001611 | 356 | 369 | PR00019 | Leucine-rich repeat | |
HMMPfam | IPR001611 | 149 | 171 | PF00560 | Leucine-rich repeat |
IPR001611 | 358 | 384 | PF00560 | Leucine-rich repeat | |
IPR009109 | 440 | 622 | PF07834 | Ran-GTPase activating protein 1 | |
HMMSmart | IPR003590 | 84 | 111 | SM00368 | Leucine-rich repeat |
IPR003590 | 147 | 174 | SM00368 | Leucine-rich repeat | |
IPR003590 | 177 | 204 | SM00368 | Leucine-rich repeat | |
IPR003590 | 215 | 242 | SM00368 | Leucine-rich repeat | |
IPR003590 | 243 | 270 | SM00368 | Leucine-rich repeat | |
IPR003590 | 271 | 298 | SM00368 | Leucine-rich repeat | |
IPR003590 | 299 | 326 | SM00368 | Leucine-rich repeat | |
IPR003590 | 328 | 355 | SM00368 | Leucine-rich repeat | |
IPR003590 | 356 | 383 | SM00368 | Leucine-rich repeat |
![]() |
Primer_f | CTTACTGCAACTTTGGCCTCC |
---|---|
Primer_r | GCTGTCAAAGTCTTCAATCTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |