KIAA1861

Gene/Protein Characteristic Table for KIAA1861

Order Kazusa clone(s) from :

Product ID	ORK00289
Accession No	AB058764
Description	coiled-coil domain containing 132
Clone name	fk12955
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3558 bp) Predicted protein sequence (979 aa)
HaloTag ORF Clone	FHC00289
Flexi ORF Clone	FXC00289
Source	Human fetal brain
Rouge ID	mKIAA1861 by Kazusa Mouse cDNA Project
Note	We replaced fh20701, former representative clones for KIAA1861 with fk12955. (2001/6/05)

Features of the cloned cDNA sequence

Description

Length: 3558 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	589 bp
Genome contig ID	gi89161213f_92599644
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- GAAATTTAATAAATATACTCTAGTATGATCAGCCT
Flanking genome sequence (226631 - 226680)	----+--------+--------+--------+--------+----* ATGTGAGACTACATTTTGATTTTTTGTGTGGCATGCAGATGTCATGAACT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	92699644	92826273	28	100.0	Perfect prediction

Features of the protein sequence

Description

Length: 979 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96JG6	99.9	Coiled-coil dom...	Homo sapiens
AAI52425	100.0	CCDC132 protein...	Homo sapiens
XP_001492692	98.5	coiled-coil dom...	Equus caballus
XP_519203	98.8	hypothetical pr...	Pan troglodytes
XP_532460	97.1	similar to CG49...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	AAATGATGTTGCCGCCTTGTC
Primer_r	CTCAGAGGGTAGAAAAGTGCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 7

Experimental conditions

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp