Order Kazusa clone(s) from : ![]() |
Product ID | ORK00289 |
---|---|
Accession No | AB058764 |
Description | coiled-coil domain containing 132 |
Clone name | fk12955 |
Vector information | |
cDNA sequence | DNA sequence (3558 bp) Predicted protein sequence (979 aa) |
Flexi ORF Clone | FXC00289 |
Source | Human fetal brain |
Rouge ID |
mKIAA1861
by Kazusa Mouse cDNA Project
|
Note | We replaced fh20701, former representative clones for KIAA1861 with fk12955. (2001/6/05) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 589 bp |
---|---|
Genome contig ID | gi89161213f_92599644 |
PolyA signal sequence (AATAAA,-28) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (226631 - 226680) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | f | 92699644 | 92826273 | 28 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | AAATGATGTTGCCGCCTTGTC |
---|---|
Primer_r | CTCAGAGGGTAGAAAAGTGCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |