Order Kazusa clone(s) from : ![]() |
Product ID | ORK00290 |
---|---|
Accession No | AB058769 |
Description | fibronectin type III domain containing 1 |
Clone name | pf09734 |
Vector information | |
cDNA sequence | DNA sequence (6016 bp) Predicted protein sequence (1783 aa) |
HaloTag ORF Clone |
FHC00290
![]() |
Flexi ORF Clone | FXC00290 |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA1866
by Kazusa Mouse cDNA Project
|
Note | We replaced fj14461, former representative clones for KIAA1866 with pf09734. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 663 bp |
---|---|
Genome contig ID | gi89161210f_159438467 |
PolyA signal sequence (ATTAAA,-31) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (174662 - 174711) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | f | 159538467 | 159613127 | 21 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR003961 | 13 | 81 | PF00041 | Fibronectin |
IPR003961 | 116 | 199 | PF00041 | Fibronectin | |
IPR003961 | 218 | 305 | PF00041 | Fibronectin | |
IPR003961 | 1544 | 1631 | PF00041 | Fibronectin | |
HMMSmart | IPR003961 | 1 | 78 | SM00060 | Fibronectin |
IPR003961 | 116 | 199 | SM00060 | Fibronectin | |
IPR003961 | 218 | 302 | SM00060 | Fibronectin | |
IPR003961 | 1545 | 1628 | SM00060 | Fibronectin | |
ProfileScan | IPR003961 | 1 | 87 | PS50853 | Fibronectin |
IPR003961 | 116 | 208 | PS50853 | Fibronectin | |
IPR003961 | 217 | 312 | PS50853 | Fibronectin | |
IPR003961 | 1544 | 1638 | PS50853 | Fibronectin |
![]() |
Primer_f | AACAACCACAGTCCGAACCAC |
---|---|
Primer_r | TCATCTTCTTCAGCGTAGCAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |