KIAA1877

Product ID	ORK07003
Accession No	AB058780
Description	ST6 beta-galactosamide alpha-2,6-sialyltranferase 2, transcript variant 1
Clone name	pg00264
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6782 bp) Predicted protein sequence (534 aa)
HaloTag ORF Clone	FHC07003
Flexi ORF Clone	FXC07003
Source	Human brain (hippocampus)
Rouge ID	mKIAA1877 by Kazusa Mouse cDNA Project

Length: 6782 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	5073 bp
Genome contig ID	gi89161199r_106684492
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TTTTTCTTGTAAATAAAACATGTTTTCATTTGTCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGAAGTTTCTTGTTTTAATTCGTAGAAGTTACACATACAAATGAGCAAGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	106784492	106869042	6	99.1	Perfect prediction

Length: 534 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96JF0	0	100.0	Beta-galactosid...	Homo sapiens
XP_515705	0	99.2	beta-galactosid...	Pan troglodytes
Q701R4	0	98.9	Beta-galactosid...	Pan troglodytes
XP_001109602	0	97.2	similar to beta...	Macaca mulatta
NP_001135824	2.1e-188	98.2	ST6 beta-galact...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001675	243	511	PF00777	Glycosyl transferase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	16	RMLFGIFAWGLLFLLIFIYFTDS	38	PRIMARY	23

Primer_f	ATGAGTGCCAGTATGTGATTG
Primer_r	TCTGATAATTCCCCTGGTCCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	ATGAGTGCCAGTATGTGATTG
Primer_r	TCTGATAATTCCCCTGGTCCC
PCR product length	95 bp
PCR conditions	15 °C62 sec60 °C30 sec178 cycles