KIAA1885

Product ID	ORK00295
Accession No	AB067472
Description	valyl-tRNA synthetase 2, mitochondrial, transcript variant 2
Clone name	fj04812
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4070 bp) Predicted protein sequence (1098 aa)
HaloTag ORF Clone	FHC00295
Flexi ORF Clone	FXC00295
Source	Human fetal brain
Rouge ID	mKIAA1885 by Kazusa Mouse cDNA Project

Length: 4070 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	246 bp
Genome contig ID	gi89161210f_30889961
PolyA signal sequence (GATAAA,-19)	+--------+--------+----*----+---- GGAATGAGGAGATTGAGATAAACTTTTGAAATCCC
Flanking genome sequence (112253 - 112302)	----+--------+--------+--------+--------+----* AAACATGTCTGTTTATGGCTCTTTGGTCCCCTTTGCTCCCAGTGGTGACT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	30989961	31002212	29	99.7	Perfect prediction

Length: 1098 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92716	98.8	VARS2L protein ...	Homo sapiens
BAG65557	99.4	unnamed protein...	Homo sapiens
Q5ST30	100.0	Valyl-tRNA synt...	Homo sapiens
CAI18004	99.9	valyl-tRNA synt...	Homo sapiens
EAX03348	99.8	valyl-tRNA synt...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002303	174	185	PR00986	Valyl-tRNA synthetase
	IPR002303	386	403	PR00986	Valyl-tRNA synthetase
	IPR002303	502	515	PR00986	Valyl-tRNA synthetase
	IPR002303	614	635	PR00986	Valyl-tRNA synthetase
	IPR002303	645	663	PR00986	Valyl-tRNA synthetase
HMMPfam	IPR002300	147	770	PF00133	Aminoacyl-tRNA synthetase
HMMPfam	IPR013155	814	967	PF08264	Valyl/Leucyl/Isoleucyl-tRNA synthetase
HMMTigr	IPR002303	135	1074	TIGR00422	Valyl-tRNA synthetase
ScanRegExp	IPR001412	181	192	PS00178	Aminoacyl-tRNA synthetase

Primer_f	TCTTCGCTTTATCCTCAATGC
Primer_r	GAGGTTGTGAAGCCAGAAGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-