KIAA1892

Product ID	ORK00942
Accession No	AB067479
Description	DDB1 and CUL4 associated factor 12
Clone name	fk04164
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3591 bp) Predicted protein sequence (476 aa)
HaloTag ORF Clone	FHC00942
Flexi ORF Clone	FXC00942
Source	Human fetal brain
Rouge ID	mKIAA1892 by Kazusa Mouse cDNA Project

Length: 3591 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1967 bp
Genome contig ID	gi89161216r_33976411
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTTGCCAAGGAAAAAAATAAAAATTATTCCAGTGC
Flanking genome sequence (99975 - 99926)	----+--------+--------+--------+--------+----* ACAATGGTGTGAGTGAGTATTGTGTAGCCAGGAGCCTGCCAAAAAGGCCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	r	34076386	34116691	9	99.4	Perfect prediction

Length: 476 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q5T6F0	1.4e-200	100.0	WD repeat-conta...	Homo sapiens
AAH63823	3.5e-200	99.8	WD repeat domai...	Homo sapiens
XP_538706	3.1e-199	99.3	similar to WD r...	Canis lupus fam...
Q4R3J7	6.7e-199	99.1	WD repeat-conta...	Macaca fascicularis
XP_001098592	1.7e-198	98.9	similar to WD r...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001680	196	234	PF00400	WD40 repeat
HMMSmart	IPR001680	100	139	SM00320	WD40 repeat
	IPR001680	195	234	SM00320	WD40 repeat
	IPR001680	259	303	SM00320	WD40 repeat
	IPR001680	351	389	SM00320	WD40 repeat
ProfileScan	IPR001680	203	243	PS50082	WD40 repeat
ProfileScan	IPR001680	203	243	PS50294	WD40 repeat
ScanRegExp	IPR001680	221	235	PS00678	WD40 repeat

Primer_f	CTCTGCTTTTCTGTCAACATC
Primer_r	CTGTGGTATGTGCTGTGTAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-