KIAA1911

Gene/Protein Characteristic Table for KIAA1911

Order Kazusa clone(s) from :

Product ID	ORK00947
Accession No	AB067498
Description	establishment of sister chromatid cohesion N-acetyltransferase 1
Clone name	fj02022
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4435 bp) Predicted protein sequence (864 aa)
HaloTag ORF Clone	FHC00947
Flexi ORF Clone	FXC00947
Source	Human fetal brain
Rouge ID	mKIAA1911 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 4435 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1042 bp
Genome contig ID	gi51511735r_17263260
PolyA signal sequence (AATAAA,-30)	+--------+--------+----*----+---- AAAATAATAAAATACTTGATAGCTTTTTCTAAGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCAATGTACTAACTGAGAATAATGGTGTGTTGTCATTTGTGCTTTTTCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	18	r	17363260	17434627	12	99.5	Perfect prediction

Features of the protein sequence

Description

Length: 864 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10178	100.0	N-acetyltransfe...	synthetic construct
Q5FWF5	99.9	N-acetyltransfe...	Homo sapiens
AAH89426	99.8	Establishment o...	Homo sapiens
XP_523883	99.2	establishment o...	Pan troglodytes
XP_001091733	96.2	similar to esta...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TCCTGAAGACCCAAAGTATGC
Primer_r	ATGTTCCGCAATTAGGCAGCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 18

Experimental conditions

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp